The Detection of Bacterial Pathogens, including Emerging Klebsiella pneumoniae, Associated with Mastitis in the Milk of Ruminant Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. General Work Flow for Milk Samples Derived from Livestock Species
2.2. DNA Isolation from Isolated Colonies
2.3. DNA/RNA Isolation from Animal Milk Samples
2.4. Confirmation of Colonies by the Conventional Polymerase Chain Reaction
2.5. Phenotypic Analysis of the Antibiotic Resistance of Klebsiella pneumoniae
2.6. Real-Time PCR for the Amplification of Seven Bacterial Pathogens in the Milk Samples
2.7. Statistical Analysis
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Food and Agricultural Organization of the United Nations (FAO). Gateway to Dairy Production and Products: Milk and Milk Products. Available online: https://www.fao.org/dairy-production-products/products/en/ (accessed on 24 December 2022).
- OECD/FAO. OECD-FAO Agricultural Outlook 2020–2029; FAO: Rome, Italy; OECD Publishing: Paris, France, 2020. [Google Scholar] [CrossRef]
- Eurostat: Statistics Explained. Available online: https://ec.europa.eu/eurostat/statistics-explained/index.php?title=Milk_and_milk_product_statistics (accessed on 24 December 2022).
- Frank, J.F. Milk and dairy products. In Food Microbiology—Fundamental and Frontiers; Doyle, P., Beuchat, R., Montville, J., Eds.; ASM Press: Herndon, VA, USA, 1997. [Google Scholar]
- Quigley, L.; O’Sullivan, O.; Beresford, T.P.; Ross, R.P.; Fitzgerald, G.F.; Cotter, P.D. Molecular approaches to analysing the microbial composition of raw milk and raw milk cheese. Int. J. Food Microbiol. 2021, 150, 81–94. [Google Scholar] [CrossRef] [PubMed]
- Coppola, S.; Blaiotta, G.; Ercolini, D.; Moschetti, G. Molecular evaluation of microbial diversity occurring in different types of Mozzarella cheese. J. Appl. Microbiol. 2001, 90, 414–420. [Google Scholar] [CrossRef] [PubMed]
- European Commission. RASFF—Food and Feed Safety Alerts. 2023. Available online: https://ec.europa.eu/food/safety/rasff_en (accessed on 28 July 2023).
- Vasavada, P.C. Pathogenic Bacteria in Milk—A Review. J. Dairy Sci. 1987, 71, 2809–2816. [Google Scholar] [CrossRef] [PubMed]
- Griffin, S.; Falzon, O.; Camilleri, K.; Valdramidis, V.P. Bacterial and fungal contaminants in caprine and ovine cheese: A meta-analysis assessment. Food Res. Int. 2020, 137, 109445. [Google Scholar] [CrossRef] [PubMed]
- Velázquez-Ordoñez, V.; Valladares-Carranza, B.; Tenorio-Borroto, E.; Talavera-Rojas, M.; Varela-Guerrero, J.A.; Acosta-Dibarrat, J.; Puigvert, F.; Grille, L.; Revello, Á.G.; Pareja, L. Microbial Contamination in Milk Quality and Health Risk of the Consumers of Raw Milk and Dairy Products. In Nutrition in Health and Disease—Our Challenges Now and Forthcoming Time; Mózsik, G., Figler, M., Eds.; IntechOpen: London, UK, 2019. [Google Scholar] [CrossRef]
- Cheng, W.N.; Han, S.G. Bovine mastitis: Risk factors, therapeutic strategies, and alternative treatments—A review. Asian-Australas. J. Anim. Sci. 2020, 33, 1699–1713. [Google Scholar] [CrossRef] [PubMed]
- Taponen, S.; McGuinness, D.; Hiitiö, H.; Simojoki, H.; Pyorala, S. Bovine milk microbiome: A more complex issue than expected. Vet. Res. 2019, 50, 44. [Google Scholar] [CrossRef]
- Bergonier, D.; de Crémoux, R.; Rupp, R.; Lagriffoul, G.; Berthelot, X. Mastitis of dairy small ruminants. Vet. Res. 2003, 34, 689–716. [Google Scholar] [CrossRef]
- Menzies, P.I.; Ramanoon, S.Z. Mastitis of sheep and goats. Vet. Clin. N. Am. Food Anim. Pract. 2001, 17, 333–358. [Google Scholar] [CrossRef]
- Vasudevan, P.; Nair, M.K.M.; Annamalai, T.; Venkitanarayanan, K.S. Phenotypic and genotypic characterization of bovine mastitis isolates of Staphylococcus aureus for biofilm formation. Vet. Microbiol. 2003, 92, 179–185. [Google Scholar] [CrossRef]
- Titouche, Y.; Akkou, M.; Houali, K.; Auvray, F.; Hennekinne, J.A. Role of milk and milk products in the spread of methicillin-resistant Staphylococcus aureus in the dairy production chain. J. Food Sci. 2022, 87, 3699–3723. [Google Scholar] [CrossRef]
- Klaas, I.C.; Zadoks, R. An update on environmental mastitis: Challenging perceptions. Transbound. Emerg. Dis. Suppl. 2017, 65, 166–185. [Google Scholar] [CrossRef] [PubMed]
- Ahmadi, M.; Rohani, S.M.; Ayremlou, N. Detection of Staphylococcus aureus in milk by PCR. Comp. Clin. Path. 2010, 19, 91–94. [Google Scholar] [CrossRef]
- Tomao, P.; Pirolo, M.; Agnoletti, F.; Pantosti, A.; Battisti, A.; Di Martino, G.; Visaggio, D.; Monaco, M.; Franco, A.; Pimentel de Araujo, F.; et al. Molecular epidemiology of methicillin-resistant Staphylococcus aureus from dairy farms in North-eastern Italy. Int. J. Food Microbiol. 2020, 332, 108817. [Google Scholar] [CrossRef] [PubMed]
- Aerts, M.; Battisti, A.; Hendriksen, R.; Kempf, I.; Teale, C.; Tenhagen, B.A.; Veldman, K.; Wasyl, D.; Guerra, B.; Liébana, E.; et al. Technical specifications on harmonised monitoring of antimicrobial resistance in zoonotic and indicator bacteria from food-producing animals and food. EFSA J. 2013, 17, 5709. [Google Scholar] [CrossRef]
- World Health Organization. Antimicrobial Resistance: Global Report on Surveillance; World Health Organization: Geneva, Switzerland, 2014; Available online: https://apps.who.int/iris/handle/10665/112642 (accessed on 10 September 2023).
- Abdalhamed, A.M.; Zeedan, G.S.G.; Abou Zeina, H.A.A. Isolation and identification of bacteria causing mastitis in small ruminants and their susceptibility to antibiotics, honey, essential oils, and plant extracts. Vet. World 2018, 11, 355–362. [Google Scholar] [CrossRef]
- Cheng, J.; Zhang, J.; Han, B.; Barkema, H.W.; Cobo, E.R.; Kastelic, J.P.; Zhou, M.; Shi, Y.; Wang, J.; Yang, R.; et al. Klebsiella pneumoniae isolated from bovine mastitis is cytopathogenic for bovine mammary epithelial cells. J. Dairy Sci. 2020, 103, 3493–3504. [Google Scholar] [CrossRef]
- Juan, C.H.; Chuang, C.; Chen, C.H.; Li, L.; Lin, Y.T. Clinical characteristics, antimicrobial resistance and capsular types of community-acquired, healthcare-associated, and nosocomial Klebsiella pneumoniae bacteremia. Antimicrob. Resist. Infect. Control 2019, 8, 1. [Google Scholar] [CrossRef]
- Marr, C.M.; Russo, T.A. Hypervirulent Klebsiella pneumoniae: A new public health threat. Expert Rev. Anti Infect. Ther. 2018, 17, 71–73. [Google Scholar] [CrossRef]
- Zheng, Z.; Gorden, P.J.; Xia, X.; Zheng, Y.; Li, G. Whole-genome analysis of Klebsiella pneumoniae from bovine mastitis milk in the US. Environ. Microbiol. 2022, 24, 1183–1199. [Google Scholar] [CrossRef]
- Ke, D.; Picard, F.J.; Martineau, F.; Ménard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Development of a PCR assay for rapid detection of enterococci. J. Clin. Microbiol. 1999, 37, 3497–3503. [Google Scholar] [CrossRef]
- Sunagar, R.; Deore, S.N.; Deshpande, P.V.; Rizwan, A.; Sannejal, A.D.; Sundareshan, S.; Rawoo, D.B.; Barbuddhe, S.B.; Jhala, M.K.; Bannalikar, A.S.; et al. Differentiation of Staphylococcus aureus and Staphylococcus epidermidis by PCR for the fibrinogen binding protein gene. J. Dairy Sci. 2013, 96, 2857–2865. [Google Scholar] [CrossRef] [PubMed]
- Morot-Bizot, S.C.; Talon, R.; Leroy, S. Development of a multiplex PCR for the identification of Staphylococcus genus and four staphylococcal species isolated from food. J. Appl. Microbiol. 2004, 97, 1087–1094. [Google Scholar] [CrossRef] [PubMed]
- Munoz, M.A.; Ahlström, C.; Rauch, B.J.; Zadoks, R.N. Fecal shedding of Klebsiella pneumoniae by dairy cows. J. Dairy Sci. 2006, 89, 3425–3430. [Google Scholar] [CrossRef] [PubMed]
- Enferad, E.; Mahdavi, S. Antibiotic resistance pattern and frequency of some beta lactamase genes in Klebsiella pneumoniae isolated from raw milk samples in Iran. J. Hellenic Vet. Med. Soc. 2021, 71, 2455–2462. [Google Scholar] [CrossRef]
- Maraki, S.; Mavromanolaki, V.E.; Magkafouraki, E.; Moraitis, P.; Stafylaki, D.; Kasimati, A.; Scoulica, E. Epidemiology and in vitro activity of ceftazidime–avibactam, meropenem–vaborbactam, imipenem–relebactam, eravacycline, plazomicin, and comparators against Greek carbapenemase-producing Klebsiella pneumoniae isolates. Infection 2022, 50, 467–474. [Google Scholar] [CrossRef]
- Queenan, A.M.; Bush, K. Carbapenemases: The versatile beta-lactamases. Clin. Microbiol. Rev. 2007, 20, 440–458. [Google Scholar] [CrossRef]
- Navon-Venezia, S.; Kondratyeva, K.; Carattoli, A. Klebsiella pneumoniae: A major worldwide source and shuttle for antibiotic resistance. Klebsiella pneumoniae: A major worldwide source and shuttle for antibiotic resistance. FEMS Microbiol. Rev. 2017, 41, 252–275. [Google Scholar] [CrossRef]
- Centers for Disease Control and Prevention (CDC). Antimicrobial Resistance Threats Report. 2019. Available online: https://www.cdc.gov/drugresistance/pdf/threats-report/2019-ar-threats-report-508.pdf (accessed on 13 September 2023).
- European Centre for Disease Prevention and Control. Surveillance of Antimicrobial Resistance in Europe-Annual Epidemiologic Report for 2021 of the European Antimicrobial Resistance Surveillance Network (EARS-Net). 2021. Available online: https://www.ecdc.europa.eu/en/publications-data/surveillance-antimicrobial-resistance-europe-2021 (accessed on 14 September 2023).
- Svanbong, C. Urinary Tract Infections. In Encyclopedia of Immunology; Delves, P.J., Ed.; Elsevier Ltd.: Amsterdam, The Netherlands, 1998; pp. 2452–2454. [Google Scholar]
- Grispoldi, L.; Karama, M.; El-Ashram, S.; Saraiva, C.; García-Díez, J.; Chalias, A.; Cenci-Goga, B. Evolution and antimicrobial resistance of enterococci isolated from Pecorino and goat cheese manufactured on-farm in an area facing constraints as per EU Regulation 1305/2013 in Umbria, Italy. Ital. J. Food Saf. 2022, 11, 10070. [Google Scholar] [CrossRef]
- Nasiri, M.; Hanifian, S. Enterococcus faecalis and Enterococcus faecium in pasteurized milk: Prevalence, genotyping, and characterization of virulence traits. LWT 2022, 153, 112452. [Google Scholar] [CrossRef]
- Dapkevicius, M.D.; Sgardioli, B.; Câmara, S.P.A.; Poeta, P.; Malcata, F.X. Current Trends of Enterococci in Dairy Products: A Comprehensive Review of Their Multiple Roles. Foods 2021, 10, 821. [Google Scholar] [CrossRef]
- Hedman, P.; Ringertz, O.; Eriksson, B.; Kvarnfors, P.; Andersson, M.; Bengtsson, L.; Olsson, K. Staphylococcus saprophyticus found to be a common contaminant of food. J. Infect. 1990, 21, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Lianou, D.T.; Michael, C.K.; Fthenakis, G.C. Data on Mapping 444 Dairy Small Ruminant Farms during a Countrywide Investigation Performed in Greece. Animals 2023, 13, 2044. [Google Scholar] [CrossRef] [PubMed]
Target Genes | Primer Sequence | Amplicon Size (bp) |
---|---|---|
Enterococcus spp. | 5′-TACTGACAAACCATTCATGATG-3′R 5′-AACTTCGTCACCAACGCGAAC-3′F | 112 |
Staphylococcus epidermidis | 5′ AGTACAGAACCGTTATGCCTGGCT3′R 5′TGATGAGTCAATTCGTGCTCCCGT3′F | 720 |
Staphylococcus saprophyticus | 5′ TCAAAAAGTTTTCTAAAAAATTTAC3′R 5′ GGGCGTCCACAAAATCAATAGGA3′F | 221 |
Klebsiella pneumoniae | 5′- ATTTGAAGAGGTTGCAAACGAT-3′ R 5′- TTCACTCTGAAGTTTTCTTGTGTTC-3′F | 130 |
E. coli | 5′-GAC CTC GGT TTA GTT CAC AGA-3′ R 5′-CAC ACG CTG ACG CTG ACC A-3′ F | 585 |
Staphylococcus aureus | 5′-TCG CTT GCT ATG ATT GTG G-3′ R 5′-GCC AAT GTT CTA CCA TAG C3′ F | 359 |
Strains | Total | Bovine | Ovine | Caprine |
---|---|---|---|---|
Klebsiella pneumoniae | 20 (33.3% *) | 0/20 | 20/20 | 0/20 |
Enterococcus spp. | 40 (66.7% *) | 20/20 | 0/20 | 20/20 |
Staphylococcus saprophyticus | 20 (33.3% *) | 0/20 | 20/20 | 0/20 |
Staphylococcus aureus | 0 | 0/20 | 0/20 | 0/20 |
Staphylococcus epidermidis | 0 | 0/20 | 0/20 | 0/20 |
Escherichia coli | 0 | 0/20 | 0/20 | 0/20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsakali, E.; Tsantes, A.G.; Houhoula, D.; Laliotis, G.P.; Batrinou, A.; Halvatsiotis, P.; Tsantes, A.E. The Detection of Bacterial Pathogens, including Emerging Klebsiella pneumoniae, Associated with Mastitis in the Milk of Ruminant Species. Appl. Sci. 2023, 13, 11484. https://doi.org/10.3390/app132011484
Tsakali E, Tsantes AG, Houhoula D, Laliotis GP, Batrinou A, Halvatsiotis P, Tsantes AE. The Detection of Bacterial Pathogens, including Emerging Klebsiella pneumoniae, Associated with Mastitis in the Milk of Ruminant Species. Applied Sciences. 2023; 13(20):11484. https://doi.org/10.3390/app132011484
Chicago/Turabian StyleTsakali, Efstathia, Andreas G. Tsantes, Dimitra Houhoula, George P. Laliotis, Anthimia Batrinou, Panagiotis Halvatsiotis, and Argyrios E. Tsantes. 2023. "The Detection of Bacterial Pathogens, including Emerging Klebsiella pneumoniae, Associated with Mastitis in the Milk of Ruminant Species" Applied Sciences 13, no. 20: 11484. https://doi.org/10.3390/app132011484