Phenolic, Polysaccharides Composition, and Texture Properties during Ripening and Storage Time of New Table Grape Cultivars in Chile
Abstract
:1. Introduction
2. Results and Discussion
2.1. Evolution of Basic Physical and Chemical Variables
2.2. Evolution of Phenolic Compounds and Antioxidants in Skins
2.3. Evolution of Skin Soluble Polysaccharides
2.4. Mechanical Behavior of Red Table Grape Varieties Crimson, Timco™, and Kryssy™ during Ripening and Extended Cold Storage Period
2.5. Gene Expression
2.5.1. Genes of the Phenylpropanoid Pathway of the Berry Skins
2.5.2. Genes of the Cell Wall Metabolism of Berry Skins
3. Materials and Methods
3.1. Plant Material
3.2. Chemicals
3.3. General Chemical Composition
3.4. Phenolic Composition and Individual Anthocyanins Analyses
3.5. Polysaccharide Analysis
3.6. Texture Analysis
3.7. Analysis of Gene Expression
3.7.1. Primer Design
3.7.2. RNA Extraction from Grape Skin and cDNA Synthesis
3.7.3. Gene Expression Analysis by qPCR
3.8. Statistical Analyses
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Coombe, B.G. Relationship of Growth and Development to Changes in Sugars, Auxins, and Gibberellins in Fruit of Seeded and Seedless Varieties of Vitis vinifera. Plant Physiol. 1960, 35, 241–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coombe, B.G. Research on Development and Ripening of the Grape Berry. Am. J. Enol. Vitic. 1992, 43, 101–110. [Google Scholar] [CrossRef]
- Robinson, S.P.; Davies, C. Molecular Biology of Grape Berry Ripening. Aust. J. Grape Wine Res. 2000, 6, 175–188. [Google Scholar] [CrossRef]
- Brummell, D.A.; Harpster, M.H. Cell Wall Metabolism in Fruit Softening and Quality and Its Manipulation in Transgenic Plants. Plant Mol. Biol. 2001, 47, 311–339. [Google Scholar] [CrossRef]
- Seccia, A.; Viscecchia, R.; Nardone, G. Table Grapes as Functional Food: Consumer Preferences for Health and Environmental Attributes. BIO Web Conf. 2019, 15, 03011. [Google Scholar] [CrossRef]
- Jayasena, V.; Cameron, I. °Brix/Acid Ratio as a Predictor of Consumer Acceptability of Crimson Seedless Table Grapes. J. Food Qual. 2008, 31, 736–750. [Google Scholar] [CrossRef]
- Rolle, L.; Siret, R.; Segade, S.R.; Maury, C.; Gerbi, V.; Jourjon, F. Instrumental Texture Analysis Parameters as Markers of Table-Grape and Winegrape Quality: A Review. Am. J. Enol. Vitic. 2012, 63, 11–28. [Google Scholar] [CrossRef] [Green Version]
- Abbott, J.A. Quality Measurement of Fruits and Vegetables. Postharvest Biol. Technol. 1999, 15, 207–225. [Google Scholar] [CrossRef]
- Balic, I.; Ejsmentewicz, T.; Sanhueza, D.; Silva, C.; Peredo, T.; Olmedo, P.; Barros, M.; Verdonk, J.C.; Paredes, R.; Meneses, C.; et al. Biochemical and Physiological Study of the Firmness of Table Grape Berries. Postharvest Biol. Technol. 2014, 93, 15–23. [Google Scholar] [CrossRef]
- Peppi, M.C.; Fidelibus, M.W.; Dokoozlian, N. Abscisic Acid Application Timing and Concentration Affect Firmness, Pigmentation, and Color of `Flame Seedless’ Grapes. HortScience 2006, 41, 1440–1445. [Google Scholar] [CrossRef] [Green Version]
- Shahab, M.; Roberto, S.R.; Ahmed, S.; Colombo, R.C.; Silvestre, J.P.; Koyama, R.; de Souza, R.T. Relationship between Anthocyanins and Skin Color of Table Grapes Treated with Abscisic Acid at Different Stages of Berry Ripening. Sci. Hortic. 2020, 259, 108859. [Google Scholar] [CrossRef]
- Yang, J.; Martinson, T.E.; Liu, R.H. Phytochemical Profiles and Antioxidant Activities of Wine Grapes. Food Chem. 2009, 116, 332–339. [Google Scholar] [CrossRef]
- Cid, P.; García, M.; Pinolef, A.; Barba, P. Phenotyping Tools for Genetic Improvement of Table Grapes in Chile. Acta Hortic. 2019, 1248, 267–274. [Google Scholar] [CrossRef]
- Eurofresh. Chile’s Table Grape Exports to Rise by 29%. 2021. Available online: www.eurofresh-distribution.com/news/chiles-table-grape-exports-to-rise-by-29/ (accessed on 26 December 2022).
- Eurofresh. Chile’s Grape Exports Remain Stable Despite Drought. 2020. Available online: www.eurofresh-distribution.com/news/chiles-grape-exports-remain-stable-despite-drought (accessed on 17 September 2022).
- Reynolds, A.; Wardle, D.; Zurowski, C.; Looney, N. Phenylureas, CPPU and thidiazuron affect yield components, fruit composition, and storage potential of four seedless grape selections. J. Am. Soc. Hort. Sci. 1992, 117, 85–89. [Google Scholar] [CrossRef] [Green Version]
- Brewer, M.S. Natural Antioxidants: Sources, Compounds, Mechanisms of Action, and Potential Application. Compr. Rev. Food Sci. Food Saf. 2011, 10, 195–247. [Google Scholar] [CrossRef]
- Gallo, V.; Mastrorilli, P.; Cafagna, I.; Nitti, G.; Latronico, M.; Longobardi, F.; Minoja, A.P.; Napoli, C.; Romito, V.; Schäfer, H.; et al. Effects of agronomical practices on chemical composition of table grapes evaluated by NMR spectroscopy. J. Food Comp. Anal. 2014, 35, 44–52. [Google Scholar] [CrossRef]
- Deng, Y.; Wu, Y.; Li, Y. Effects of High O2 Levels on Post-Harvest Quality and Shelf Life of Table Grapes during Long-Term Storage. Eur. Food Res. Technol. 2005, 221, 392–397. [Google Scholar] [CrossRef]
- Lago-Vanzela, E.S.; Da-Silva, R.; Gomes, E.; García-Romero, E.; Hermosín-Gutiérrez, I. Phenolic Composition of the Brazilian Seedless Table Grape Varieties BRS Clara and BRS Morena. J. Agric. Food Chem. 2011, 59, 8314–8323. [Google Scholar] [CrossRef]
- Zhang, L.; Li, X.; Pang, Y.; Cai, X.; Lu, J.; Ren, X.; Kong, Q. Phenolics composition and contents, as the key quality parameters of table grapes, may be influenced obviously and differently in response to short-term high temperature. LWT 2021, 149, 111791. [Google Scholar] [CrossRef]
- Sheng, K.; Zheng, H.; Shui, S.; Yan, L.; Liu, C.; Zheng, L. Comparison of Postharvest UV-B and UV-C Treatments on Table Grape: Changes in Phenolic Compounds and Their Transcription of Biosynthetic Genes during Storage. Postharvest Biol. Technol. 2018, 138, 74–81. [Google Scholar] [CrossRef]
- Xie, S.; Liu, Y.; Chen, H.; Zhang, Z.; Ge, M. Anthocyanin degradation and the underlying molecular mechanism in a red-fleshed grape variety. LWT 2021, 151, 112198. [Google Scholar] [CrossRef]
- Nia, A.E.; Taghipour, S.; Siahmansou, S. Pre-harvest application of chitosan and postharvest Aloe vera gel coating enhances quality of table grape (Vitis vinifera L. cv. ‘Yaghouti’) during postharvest period. Food Chem. 2021, 347, 129012. [Google Scholar] [CrossRef]
- Downey, M.; Mazza, M.; Seddon, T.J.; Rochfort, S.; Millikan, M. Variation in Condensed Tannin Content, Composition and Polymer Length Distribution in the Skin of 36 Grape Cultivars. Curr. Bioact. Compd. 2012, 8, 200–217. [Google Scholar] [CrossRef]
- Watrelot, A.; Norton, E. Chemistry and Reactivity of Tannins in Vitis spp.: A Review. Molecules 2020, 25, 2110. [Google Scholar] [CrossRef] [PubMed]
- Downey, M.O.; Harvey, J.S.; Robinson, S.P. Synthesis of Flavonols and Expression of Flavonol Synthase Genes in the Developing Grape Berries of Shiraz and Chardonnay (Vitis vinifera L.). Aust. J. Grape Wine Res. 2003, 9, 110–121. [Google Scholar] [CrossRef]
- Bogs, J.; Downey, M.O.; Harvey, J.S.; Ashton, A.R.; Tanner, G.J.; Robinson, S.P. Proanthocyanidin Synthesis and Expression of Genes Encoding Leucoanthocyanidin Reductase and Anthocyanidin Reductase in Developing Grape Berries and Grapevine Leaves. Plant Physiol. 2005, 139, 652–663. [Google Scholar] [CrossRef] [Green Version]
- Eshghi, S.; Karimi, R.; Shiri, A.; Karami, M.; Moradi, M. Effects of polysaccharide-based coatings on postharvest storage life of grape: Measuring the changes in nutritional, antioxidant and phenolic compounds. J. Food Meas. Charact. 2022, 16, 1159–1170. [Google Scholar] [CrossRef]
- Razungles, A.; Bayonove, C.L.; Cordonnier, R.E.; Sapis, J.C. Grape Carotenoids: Changes During the Maturation Period and Localization in Mature Berries. Am. J. Enol. Vitic. 1988, 39, 44–48. [Google Scholar] [CrossRef]
- Doshi, P.; Adsule, P.; Banerjee, K. Phenolic Composition and Antioxidant Activity in Grapevine Parts and Berries (Vitis vinifera L.) Cv. Kishmish Chornyi (Sharad Seedless) during Maturation. Int. J. Food Sci. Technol. 2006, 41, 1–9. [Google Scholar] [CrossRef]
- Benbouguerra, N.; Richard, T.; Saucier, C.; Garcia, F. Voltammetric Behavior, Flavanol and Anthocyanin Contents, and Antioxidant Capacity of Grape Skins and Seeds during Ripening (Vitis vinifera Var. Merlot, Tannat, and Syrah). Antioxidants 2020, 9, 800. [Google Scholar] [CrossRef]
- Nicolosi, E.; Ferlito, F.; Amenta, M.; Russo, T.; Rapisarda, P. Changes in the Quality and Antioxidant Components of Minimally Processed Table Grapes during Storage. Sci. Hortic. 2018, 232, 175–183. [Google Scholar] [CrossRef]
- Downey, M.O.; Dokoozlian, N.K.; Krstic, M.P. Cultural Practice and Environmental Impacts on the Flavonoid Composition of Grapes and Wine: A Review of Recent Research. Am. J. Enol. Vitic. 2006, 57, 257–268. [Google Scholar] [CrossRef]
- De Pascual-Teresa, S.; Sanchez-Ballesta, M.T. Anthocyanins: From Plant to Health. Phytochem. Rev. 2008, 7, 281–299. [Google Scholar] [CrossRef]
- Albersheim, P.; Darvill, A.; Roberts, K.; Sederoff, R.; Staehelin, A. Plant Cell Walls. From Chemistry to Biology. Ann. Bot. 2011, 108, viii–ix. [Google Scholar] [CrossRef] [Green Version]
- Guadalupe, Z.; Ayestarán, B.; Williams, P.; Doco, T. Determination of Must and Wine Polysaccharides by Gas Chromatography-Mass Spectrometry (GC-MS) and Size-Exclusion Chromatography (SEC). In Polysaccharides; Springer International Publishing: Cham, Switzerland, 2015; pp. 1–28. [Google Scholar]
- Garrido-Bañuelos, G.; Buica, A.; Schückel, J.; Zietsman, A.J.J.; Willats, W.G.T.; Moore, J.P.; Du Toit, W.J. Investigating the Relationship between Grape Cell Wall Polysaccharide Composition and the Extractability of Phenolic Compounds into Shiraz Wines. Part I: Vintage and Ripeness Effects. Food Chem. 2019, 278, 36–46. [Google Scholar] [CrossRef]
- Nunan, K.J.; Sims, I.M.; Bacic, A.; Robinson, S.P.; Fincher, G.B. Changes in Cell Wall Composition during Ripening of Grape Berries. Plant Physiol. 1998, 118, 783–792. [Google Scholar] [CrossRef] [Green Version]
- Nunan, K.J.; Davies, C.; Robinson, S.P.; Fincher, G.B. Expression Patterns of Cell Wall-Modifying Enzymes during Grape Berry Development. Planta 2001, 214, 257–264. [Google Scholar] [CrossRef]
- Fasoli, M.; Dell’Anna, R.; Dal Santo, S.; Balestrini, R.; Sanson, A.; Pezzotti, M.; Monti, F.; Zenoni, S. Pectins, Hemicelluloses and Celluloses Show Specific Dynamics in the Internal and External Surfaces of Grape Berry Skin During Ripening. Plant Cell Physiol. 2016, 57, 1332–1349. [Google Scholar] [CrossRef] [Green Version]
- Ortega-Regules, A.; Ros-García, J.M.; Bautista-Ortín, A.B.; López-Roca, J.M.; Gómez-Plaza, E. Changes in Skin Cell Wall Composition during the Maturation of Four Premium Wine Grape Varieties. J. Sci. Food Agric. 2008, 88, 420–428. [Google Scholar] [CrossRef]
- Gil, M.; Quiros, M.; Fort, F.; Morales, P.; Gonzalez, R.; Canals, J.-M.; Zamora, F. Influence of Grape Maturity and Maceration Length on Polysaccharide Composition of Cabernet Sauvignon Red Wines. Am. J. Enol. Vitic. 2015, 66, 393–397. [Google Scholar] [CrossRef] [Green Version]
- Vargas, A.; Perez, J.; Pablo Zoffoli, J.; Perez, A. Evolution of the Texture in Thompson Seedless Berries. Cien. Investig. Agric. 2001, 27, 117–126. [Google Scholar] [CrossRef]
- Letaief, H.; Rolle, L.; Zeppa, G.; Gerbi, V. Assessment of Grape Skin Hardness by a Puncture Test. J. Sci. Food Agric. 2008, 88, 1567–1575. [Google Scholar] [CrossRef]
- Cliff, M.A.; Dever, M.C.; Reynolds, A.G. Descriptive Profiling of New and Commercial British Columbia Table Grape Cultivars. Am. J. Enol. Vitic. 1996, 47, 301–308. [Google Scholar] [CrossRef]
- Torchio, F.; Cagnasso, E.; Gerbi, V.; Rolle, L. Mechanical Properties, Phenolic Composition and Extractability Indices of Barbera Grapes of Different Soluble Solids Contents from Several Growing Areas. Anal. Chim. Acta 2010, 660, 183–189. [Google Scholar] [CrossRef] [PubMed]
- Conner, P.J. Instrumental Textural Analysis of Muscadine Grape Germplasm. HortScience 2013, 48, 1130–1134. [Google Scholar] [CrossRef]
- Zouid, I.; Siret, R.; Mehinagic, E.; Maury, C.; Chevalier, M.; Jourjon, F. Evolution of Grape Berries during Ripening: Investigations into the Links between Their Mechanical Properties and the Extractability of Their Skin Anthocyanins. OENO One 2010, 44, 87. [Google Scholar] [CrossRef]
- Maury, C.; Madieta, E.; Le Moigne, M.; Mehinagic, E.; Siret, R.; Jourjon, F. Development of a Mechanical Texture Test to Evaluate the Ripening Process of Cabernet Franc Grapes. J. Texture Stud. 2009, 40, 511–535. [Google Scholar] [CrossRef]
- Van Hecke, E.; Allaf, K.; Bouvier, J.M. Texture and Structure of Crispy-Puffed Food Products Part Ii: Mechanical Properties in Puncture. J. Texture Stud. 1998, 29, 617–632. [Google Scholar] [CrossRef]
- Roudaut, G.; Dacremont, C.; Vallès Pàmies, B.; Colas, B.; Le Meste, M. Crispness: A Critical Review on Sensory and Material Science Approaches. Trends Food Sci. Technol. 2002, 13, 217–227. [Google Scholar] [CrossRef]
- Bourne, M.C. Practice of Objective Texture Measurement. In Food Texture and Viscosity; Academic Press: New York, NY, USA, 1982; pp. 118–198. [Google Scholar]
- Saeleaw, M.; Schleining, G. A Review: Crispness in Dry Foods and Quality Measurements Based on Acoustic–Mechanical Destructive Techniques. J. Food Eng. 2011, 105, 387–399. [Google Scholar] [CrossRef]
- Boss, P.K.; Davies, C.; Robinson, S.P. Analysis of the Expression of Anthocyanin Pathway Genes in Developing Vitis Vinifera L. Cv Shiraz Grape Berries and the Implications for Pathway Regulation. Plant Physiol. 1996, 111, 1059–1066. [Google Scholar] [CrossRef] [Green Version]
- Nakatsuka, T.; Nishihara, M.; Mishiba, K.; Yamamura, S. Temporal Expression of Flavonoid Biosynthesis-Related Genes Regulates Flower Pigmentation in Gentian Plants. Plant Sci. 2005, 168, 1309–1318. [Google Scholar] [CrossRef]
- Kobayashi, S.; Goto-Yamamoto, N.; Hirochika, H. Association of VvmybA1 Gene Expression with Anthocyanin Production in Grape (Vitis vinifera) Skin-Color Mutants. J. Jpn. Soc. Hortic. Sci. 2005, 74, 196–203. [Google Scholar] [CrossRef] [Green Version]
- Nakajima, J.; Tanaka, Y.; Yamazaki, M.; Saito, K. Reaction Mechanism from Leucoanthocyanidin to Anthocyanidin 3-Glucoside, a Key Reaction for Coloring in Anthocyanin Biosynthesis. J. Biol. Chem. 2001, 276, 25797–25803. [Google Scholar] [CrossRef] [Green Version]
- Castellarin, S.D.; Di Gaspero, G. Transcriptional Control of Anthocyanin Biosynthetic Genes in Extreme Phenotypes for Berry Pigmentation of Naturally Occurring Grapevines. BMC Plant Biol. 2007, 7, 46. [Google Scholar] [CrossRef] [Green Version]
- Castellarin, S.D.; Gambetta, G.A.; Wada, H.; Shackel, K.A.; Matthews, M.A. Fruit Ripening in Vitis vinifera: Spatiotemporal Relationships among Turgor, Sugar Accumulation, and Anthocyanin Biosynthesis. J. Exp. Bot. 2011, 62, 4345–4354. [Google Scholar] [CrossRef] [Green Version]
- Glissant, D.; Dédaldéchamp, F.; Delrot, S. Transcriptomic Analysis of Grape Berry Softening during Ripening. OENO One 2008, 42, 1. [Google Scholar] [CrossRef]
- Terrier, N.; Glissant, D.; Grimplet, J.; Barrieu, F.; Abbal, P.; Couture, C.; Ageorges, A.; Atanassova, R.; Léon, C.; Renaudin, J.-P.; et al. Isogene Specific Oligo Arrays Reveal Multifaceted Changes in Gene Expression during Grape Berry (Vitis vinifera L.) Development. Planta 2005, 222, 832–847. [Google Scholar] [CrossRef]
- Barnavon, L.; Doco, T.; Terrier, N.; Ageorges, A.; Romieu, C.; Pellerin, P. Involvement of Pectin Methyl-Esterase during the Ripening of Grape Berries: Partial CDNA Isolation, Transcript Expression and Changes in the Degree of Methyl-Esterification of Cell Wall Pectins. Phytochemistry 2001, 58, 693–701. [Google Scholar] [CrossRef]
- Shevchik, V.E.; Hugouvieux-Cotte-Pattat, N. PaeX, a Second Pectin Acetylesterase of Erwinia Chrysanthemi 3937. J. Bacteriol. 2003, 185, 3091–3100. [Google Scholar] [CrossRef] [Green Version]
- Lionetti, V.; Raiola, A.; Mattei, B.; Bellincampi, D. The Grapevine VvPMEI1 Gene Encodes a Novel Functional Pectin Methylesterase Inhibitor Associated to Grape Berry Development. PLoS ONE 2015, 10, e0133810. [Google Scholar] [CrossRef] [PubMed]
- Di Matteo, A.; Giovane, A.; Raiola, A.; Camardella, L.; Bonivento, D.; De Lorenzo, G.; Cervone, F.; Bellincampi, D.; Tsernoglou, D. Structural Basis for the Interaction between Pectin Methylesterase and a Specific Inhibitor Protein. Plant Cell 2005, 17, 849–858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ishimaru, M.; Kobayashi, S. Expression of a Xyloglucan Endo-Transglycosylase Gene Is Closely Related to Grape Berry Softening. Plant Sci. 2002, 162, 621–628. [Google Scholar] [CrossRef]
- Lijavetzky, D.; Carbonell-Bejerano, P.; Grimplet, J.; Bravo, G.; Flores, P.; Fenoll, J.; Hellín, P.; Oliveros, J.C.; Martínez-Zapater, J.M. Berry Flesh and Skin Ripening Features in Vitis vinifera as Assessed by Transcriptional Profiling. PLoS ONE 2012, 7, e39547. [Google Scholar] [CrossRef]
- Vargas, A.M.; Fajardo, C.; Borrego, J.; De Andrés, M.T.; Ibáñez, J. Polymorphisms in VvPel Associate with Variation in Berry Texture and Bunch Size in the Grapevine. Aust. J. Grape Wine Res. 2013, 19, 193–207. [Google Scholar] [CrossRef]
- Ahmed, A.E.; Labavitch, J.M. Cell Wall Metabolism in Ripening Fruit. Plant Physiol. 1980, 65, 1014–1016. [Google Scholar] [CrossRef] [Green Version]
- Rosli, H.G.; Civello, P.M.; Martínez, G.A. Changes in Cell Wall Composition of Three Fragaria x Ananassa Cultivars with Different Softening Rate during Ripening. Plant Physiol. Biochem. 2004, 42, 823–831. [Google Scholar] [CrossRef]
- Schlosser, J.; Olsson, N.; Weis, M.; Reid, K.; Peng, F.; Lund, S.; Bowen, P. Cellular Expansion and Gene Expression in the Developing Grape (Vitis vinifera L.). Protoplasma 2008, 232, 255–265. [Google Scholar] [CrossRef]
- Naleway, J.J.; Coleman, D.J.; Hawley, R.M.; Cook, G.M. Cellulase Assay as a Method of Monitoring Grape Ripening. FASEB J. 2008, 22, 841.2. [Google Scholar] [CrossRef]
- Ubeda, C.; Cortiella, M.G.I.; Villalobos-Gonzalez, L.; Gomez, C.; Pastenes, C.; Peña-Neira, A. Ripening and Storage Time Effects on the Aromatic Profile of New Table Grape Cultivars in Chile. Molecules 2020, 25, 5790. [Google Scholar] [CrossRef]
- International Organisation of Vine and Wine (OIV). Compedium of International Methods of Wine and Must Analysis, 2022nd OIV ed.; International Organisation of Vine and Wine (OIV): Paris, France, 2022; Volume 1, ISBN 978-2-85038-052-5. [Google Scholar]
- Ribéreau-Gayon, P.; Glories, Y.; Maujean, A.; Dubourdieu, D. Phenolic Compounds. In Handbook of Enology, Volume 2: The Chemistry of Wine and Stabilization and Treatments; John Wiley & Sons, Ltd.: Chinchester, UK, 2006; pp. 141–203. [Google Scholar]
- Mercurio, M.D.; Dambergs, R.G.; Herderich, M.J.; Smith, P.A. High Throughput Analysis of Red Wine and Grape Phenolics-Adaptation and Validation of Methyl Cellulose Precipitable Tannin Assay and Modified Somers Color Assay to a Rapid 96 Well Plate Format. J. Agric. Food Chem. 2007, 55, 4651–4657. [Google Scholar] [CrossRef]
- Peña-Neira, A.; Cáceres, A.; Pastenes, C. Low Molecular Weight Phenolic and Anthocyanin Composition of Grape Skins from Cv. Syrah (Vitis vinifera L.) in the Maipo Valley (Chile): Effect of Clusters Thinning and Vineyard Yield. Food Sci. Technol. Int. 2007, 13, 153–158. [Google Scholar] [CrossRef]
- Cejudo-Bastante, M.J.; del Barrio-Galan, R.; Heredia, F.J.; Medel-Maraboli, M.; Peña-Neira, A. Location effects on the polyphenolic and polysaccharidic profiles and colour of Carignan grape variety wines from the Chilean Maule region. Food Res. Int. 2018, 106, 729–735. [Google Scholar] [CrossRef]
- Gil-Cortiella, M.; Peña-Neira, Á. Extraction of Soluble Polysaccharides from Grape Skins. Cienc. Investig. Agrar. 2017, 44, 83–93. [Google Scholar] [CrossRef] [Green Version]
- González-Agüero, M.; García-Rojas, M.; Di Genova, A.; Correa, J.; Maass, A.; Orellana, A.; Hinrichsen, P. Identification of Two Putative Reference Genes from Grapevine Suitable for Gene Expression Analysis in Berry and Related Tissues Derived from RNA-Seq Data. BMC Genom. 2013, 14, 878. [Google Scholar] [CrossRef] [Green Version]
- Aranda, P.S.; LaJoie, D.M.; Jorcyk, C.L. Bleach gel: A simple agarose gel for analyzing RNA quality. Electrophoresis 2012, 33, 366–369. [Google Scholar] [CrossRef] [Green Version]
Variable | Cultivar | Period before Harvest | Period Postharvest | ||||
---|---|---|---|---|---|---|---|
Sampling Dates: | 30 January 2018 (D1) | 12 February 2018 (D2) | 26 February 2018 (D3) | 9 March 2018 (D4) | 2 May 2018 (D5) | 25 June 2018 (D6) | |
Weight of 50 berries (g) | Crimson | 244.8 ± 18.5 a | 264.6 ± 22.4 ab | 296.4 ± 25.3 b | 294.0 ± 37.9 b | 262.5 ± 22.4 ab | 262.7 ± 27.8 ab |
Timco™ | 420.8 ± 21.2 a | 471.3 ± 24.6 ab | 493.2 ± 13 ab | 522.0 ± 60.4 b | 527.8 ± 57.5 b | 526.2 ± 29.7 ab | |
Krissy™ | 331.7 ± 14.7 a | 426.7 ± 39.4 ab | 485.1 ± 28.3 b | 432.8 ± 27.2 ab | 420.1 ± 78.5 ab | 457.6 ± 90.5 b | |
Length (mm) | Crimson | 17.58 ± 0.55 a | 18.25 ± 0.25 a | 18.70 ± 0.81 a | 18.27 ± 0.84 a | 17.04 ± 0.34 a | 16.64 ± 0.56 a |
Timco™ | 21.91 ± 0.36 a | 22.71 ± 0.56 a | 22.82 ± 0.33 a | 22.68 ± 0.93 a | 22.19 ± 0.67 a | 21.96 ± 1.1 ab | |
Krissy™ | 20.87 ± 0.36 a | 22.90 ± 0.90 b | 23.83 ± 0.33 b | 22.42 ± 0.39 b | 21.75 ± 1.47 b | 21.50 ± 2.11 b | |
Equatorial diameter (mm) | Crimson | 22.52 ± 0.53 a | 24.11 ± 1.16 b | 25.20 ± 0.49 b | 24.72 ± 0.50 b | 24.06 ± 1.02 b | 23.37 ± 1.19 ab |
Timco™ | 26.73 ± 0.67 a | 28.25 ± 0.55 b | 28.77 ± 0.47 b | 30.53 ± 1.17 b | 30.14 ± 1.73 b | 29.67 ± 0.58 b | |
Krissy™ | 20.85 ± 1.06 a | 25.66 ± 0.84 b | 25.58 ± 0.67 b | 24.91 ± 0.84 b | 24.72 ± 1.25 b | 23.07 ± 2.62 ab | |
Total soluble solids (°Brix) | Crimson | 13.47 ± 0.31 c | 15.13 ± 0.12 cb | 16.87 ± 0.12 b | 18.73 ± 0.31 ab | 20.20 ± 0.35 ab | 21.73 ± 0.64 a |
Timco™ | 13.47 ± 0.23 c | 16.20 ± 0.20 bc | 17.27 ± 0.31 b | 18.73 ± 0.23 ab | 19.40 ± 0.20 a | 21.40 ± 0.35 a | |
Krissy™ | 13.60 ± 0.20 c | 16.07 ± 0.31 bc | 18.33 ± 0.12 bc | 19.40 ± 0.53 b | 20.87 ± 1.01 ab | 22.07 ± 0.31 a | |
pH | Crimson | 2.90 ± 0.01 a | 3.18 ± 0.04 a | 3.16 ± 0.02 a | 3.35 ± 0.52 a | 3.50 ± 0.02 a | 3.54 ± 0.04 a |
Timco™ | 2.92 ± 0.03 a | 3.21 ± 0.06 a | 3.26 ± 0.06 b | 3.36 ± 0.02 a | 3.50 ± 0.02 a | 3.56 ± 0.05 a | |
Krissy™ | 2.90 ± 0.02 a | 3.17 ± 0.07 a | 3.30 ± 0.03 b | 3.40 ± 0.04 a | 3.50 ± 0.06 a | 3.54 ± 0.01 a | |
Titratable acidity (g H2SO4/L) | Crimson | 6.35 ± 0.10 ab | 5.97 ± 0.26 b | 3.68 ± 0.21 b | 3.22 ± 0.14 c | 3.95 ± 0.24 b | 3.98 ± 0.11 b |
Timco™ | 6.62 ± 0.60 a | 5.36 ± 0.34 a | 3.54 ± 0.10 a | 3.74 ± 0.07 a | 4.32 ± 0.29 a | 4.03 ± 0.10 a | |
Krissy™ | 8.20 ± 0.02 b | 7.15 ± 0.25 a | 4.32 ± 0.07 ab | 4.27 ± 0.22 bc | 5.04 ± 0.21 b | 4.8 ± 0.04 a |
Variable 1 | Cultivar | Period before Harvest | Period Postharvest | ||||
---|---|---|---|---|---|---|---|
Sampling Dates: | 30 January 2018 (D1) | 12 February 2018 (D2) | 26 February 2018 (D3) | 9 March 2018 (D4) | 2 May 2018 (D5) | 25 June 2018 (D6) | |
Total phenols (mg/g FW) | Crimson | 1.32 ± 0.09 b | 1.57 ± 0.09 c | 1.52 ± 0.18 c | 1.51 ± 0.23 c | 1.23 ± 0.03 a | 1.29 ± 0.28 ab |
Timco™ | 0.75 ± 0.10 a | 0.89 ± 0.07 b | 0.78 ± 0.41 ab | 0.75 ± 0.06 ab | 0.86 ± 0.16 b | 0.89 ± 0.15 b | |
Krissy™ | 1.45 ± 0.12 b | 1.46 ± 0.12 b | 1.33 ± 0.11 a | 1.44 ± 0.13 b | 1.87 ± 0.54 bc | 1.90 ± 0.17 c | |
Total anthocyanins (mg/g FW) | Crimson | 0.40 ± 0.03 a | 0.81 ± 0.07 c | 0.78 ± 0.09 c | 0.75 ± 0.15 c | 0.81 ± 0.04 c | 0.65 ± 0.12 b |
Timco™ | 0.33 ± 0.09 b | 0.34 ± 0.09 b | 0.33 ± 0.16 b | 0.38 ± 0.05 c | 0.29 ± 0.13 a | 0.29 ± 0.09 a | |
Krissy™ | 0.34 ± 0.03 a | 0.55 ± 0.10 b | 0.63 ± 0.06 c | 0.65 ± 0.07 c | 0.74 ± 0.27 c | 0.57 ± 0.03 b | |
Total tannins (mg/g FW) | Crimson | 6.67 ± 0.25 b | 5.77 ± 0.44 b | 5.36 ± 0.98 ab | 5.47 ± 1.33 ab | 4.75 ± 0.66 a | 4.81 ± 1.11 ab |
Timco™ | 5.61 ± 3.83 b | 3.24 ± 0.69 a | 5.87 ± 0.62 b | 3.48 ± 0.63 a | 4.38 ± 0.85 a | 5.10 ± 0.63 a | |
Krissy™ | 8.96 ± 2.94 ab | 6.57 ± 0.95 b | 6.22 ± 0.55 b | 6.57 ± 0.67 b | 9.17 ± 2.96 ab | 9.53 ± 1.63 a | |
Antioxidant activity (ORAC) (mmol/g TE FW) | Crimson | 4188 ± 195 a | 5569 ± 366 b | 5396 ± 670 b | 4627 ± 169 ab | 5477 ± 195 b | 4450 ± 212 ab |
Timco™ | 1180 ± 161 a | 2368.33 ± 484 b | 2463 ± 190 b | 2453 ± 289 b | 3105 ± 181 c | 2894 ± 286 bc | |
Krissy™ | 3428 ± 262 a | 4710 ± 327 b | 4713 ± 146 b | 3821 ± 145 ab | 3105 ± 181 a | 3088 ± 223 a | |
Delphinidin-3-glucoside (μg/g FW) | Crimson | ND | 11.1 ± 0.10 a | 12.2 ± 0.30 a | 13,4 ± 0.50 a | 13.1 ± 0.20 a | 12.6 ± 0.30 a |
Timco™ | ND | ND | ND | ND | ND | ND | |
Krissy™ | 10.10 ± 0.20 b | 7.20 ± 0.30 a | 12.01 ± 0.10 c | 10.41 ± 0.10 b | 10.31 ± 0.20 b | 9.21 ± 0.12 b | |
Cyanidin-3-glucoside (μg/g FW) | Crimson | 10.01 ± 0.31 a | 18.20 ± 0.31 b | 20.12 ± 0.27 b | 21.20 ± 0.17 b | 19.35 ± 0.21 b | 19.21 ± 1.02 b |
Timco™ | 20.12 ± 1.01 a | 19.17 ± 1.01 a | 20.67 ± 0.61 a | 19.58 ± 1.17 a | 20.02 ± 1.13 a | 19.00 ± 1.01 a | |
Krissy™ | 20.02 ± 1.00 a | 19.41 ± 1.63 a | 30.03 ± 3.44 b | 51.61 ± 4.83 bc | 50.37 ± 5.16 bc | 56.10 ± 7.12 c | |
Petunidin-3-glucoside (μg/g FW) | Crimson | ND | 10.01 ± 0.90 a | 10.71 ± 1.21 a | 11.09 ± 1.36 a | 10.21 ± 1.98 a | 10.11 ± 0.96 a |
Timco™ | ND | ND | ND | ND | ND | ND | |
Krissy™ | 11.07 ± 0.71 a | 20.12 ± 3.01 b | 20.42 ± 1.97 b | 40.25 ± 2.58 c | 17.35 ± 3.13 b | 15.01 ± 2.08 b | |
Peonidin-3-glucoside (μg/g FW) | Crimson | 70.16 ± 4.14 a | 110.41 ± 5.29 ab | 113.71 ± 4.86 b | 249.97 ± 6.19 d | 222.39 ± 4.02 c | 222.95 ± 5.06 c |
Timco™ | 40.27 ± 4.75 a | 80.62 ± 4.99 b | 100.96 ± 6.07 c | 120.82 ± 5.54 cd | 140.76 ± 7.21 d | 110.91 ± 6.95 cd | |
Krissy™ | 70.17 ± 4,29 a | 80.23 ± 7.03 a | 140.86 ± 8.32 b | 210.88 ± 6.97 c | 223.83 ± 8.23 c | 212.20 ± 6.01 cd | |
Malvidin-3-glucoside (μg/g FW) | Crimson | 113.19 ± 7.11 a | 119.41 ± 4.28 a | 127.12 ± 6.02 a | 147.44 ± 6.92 b | 172.17 ± 6.81 c | 116.19 ± 6.54 a |
Timco™ | 20.92 ± 3.81 a | 30.86 ± 5.51 b | 38.03 ± 5.86 b | 39.03 ± 2.42 b | 27.32 ± 3.81 b | 31.43 ± 4.42 b | |
Krissy™ | 31.43 ± 4.31 a | 42.74 ± 4.62 a | 91.29 ± 5.71 b | 88.28 ± 6.53 b | 44.24 ± 5.71 a | 51.45 ± 6.31 ab |
Variable 1 | Cultivar | Period before Harvest | Period Postharvest | ||||
---|---|---|---|---|---|---|---|
Sampling Dates: | 30 January 2018 (D1) | 12 February 2018 (D2) | 26 February 2018 (D3) | 9 March 2018 (D4) | 2 May 2018 (D5) | 25 June 2018 (D6) | |
F1 (mg/g of skins) | Crimson | 134.1 ± 12.4 bc | 161.1 ± 12.2 bc | 164.4 ± 109.5 c | 81.3 ± 4.8 ab | 79 ± 52.8 ab | 25.1 ± 9.8 a |
Timco™ | ND | ND | ND | 13 ± 1.4 a | 20.5 ± 4.2 ab | 22.3 ± 5.4 b | |
Krissy™ | 23.2 ± 4.9 ab | 24.7 ± 16.1 b | 16.6 ± 3.8 ab | 15.7 ± 1.8 ab | 9.4 ± 1.2 a | 12.9 ± 4 ab | |
F2 (mg/g of skins) | Crimson | 354.5 ± 35.9 c | 374 ± 17.1 c | 308.3 ± 21.6 c | 281.7 ± 16.7 bc | 127.3 ± 44.6 a | 163.1 ± 4 ab |
Timco™ | 179.7 ± 38.4 b | 118.8 ± 14.7 a | 113.5 ± 43.9 a | 209.5 ± 8.2 b | 209.2 ± 36.9 b | 206.1 ± 33.9 b | |
Krissy™ | 153.6 ± 26.9 ab | 123.7 ± 26.6 ab | 129.4 ± 11.0 ab | 159.8 ± 24.7 b | 113.7 ± 14.6 a | 147.1 ± 24.5 ab | |
F3 (mg/g of skins) | Crimson | 266.7 ± 3.1 c | 297.8 ± 29.9 cd | 320.4 ± 10 d | 147.4 ± 15.7 b | 71.8 ± 28 a | 101.6 ± 10.7 a |
Timco™ | 173.9 ± 82.4 b | 89.1 ± 6.7 a | 59.7 ± 29.6 d | 98.7 ± 15.5 a | 97.4 ± 7.7 a | 109.9 ± 14.7 ab | |
Krissy™ | 227.9 ± 40.4 c | 185.4 ± 79.3 bc | 116.9 ± 25.0 ab | 119.4 ± 16.3 ab | 84.7 ± 11.2 a | 116.9 ± 16.4 ab | |
Total polysaccharides (mg/g of skins) | Crimson | 755.3 ± 30.3 c | 832.8 ± 50.1 c | 793.1 ± 335.4 c | 510.4 ± 14.4 b | 278.1 ± 119.1 a | 289.8 ± 23.1 a |
Timco™ | 353.6 ± 118.9 c | 207.9 ± 12.2 ab | 173.2 ± 73.5 a | 321.2 ± 11.9 bc | 327.1 ± 40.8 bc | 338.3 ± 53.8 c | |
Krissy™ | 404.7 ± 59.3 c | 333.8 ± 83.6 bc | 262.8 ± 32 ab | 294.9 ± 38.7 ab | 207.8 ± 24.7 a | 276.9 ± 42.7 ab |
Gene Abv | Accession | Sense | Sequence (5′→3′) | Amplicon (bp) | Tm (°C) | Efficiency |
---|---|---|---|---|---|---|
CEL | AY043236.1 | Forward | TTCTCCCAAGCCCAGTACACCC | 147 | 61.0 | 1.81 |
Reverse | AGTTCCACCGCAGTTCACAACT | |||||
PEL | NM_001281122.1 | Forward | GTGGAGGCATTGGAACTGGAGA | 121 | 60.9 | 1.78 |
Reverse | TGGTCTGGCACTCAAGCTGGAA | |||||
XET1 | AY043237.1 | Forward | AGCCTCTGGAATGCGGATGACT | 123 | 61.1 | 1.96 |
Reverse | TGTGCTTGTGGAGGTGGAAGTG | |||||
XET2 | AY043238.1 | Forward | AGCCTGTGGAATGCGGATGACT | 121 | 61.45 | 1.98 |
Reverse | CCACTGAAGCCTCACACCCATC | |||||
PME | NM_001281162.1 | Forward | GTGATGCCACGGTGGTCTTCCA | 85 | 62.8 | 1.96 |
Reverse | CCTTGGGCGGTGATGGTGTTCT | |||||
GRIP28 | NM_001281212.1 | Forward | GCAGTTGGCTCACACCGCTTTG | 125 | 62.4 | 2.05 |
Reverse | AACAGTCCTGAACCGCCTCCAA | |||||
F3′H | NM_001280987.1 | Forward | AGGAGGAGGTTGCGGTGCTAAC | 132 | 62.3 | 1.98 |
Reverse | CGCCGAACACTCTCCTGCCTAA | |||||
F3′5′H | NM_001281235.1 | Forward | TCCATCGCATGGCTGGACATCC | 101 | 62.55 | 1.93 |
Reverse | GCCGTGTGCTCCTCCATCATCT | |||||
UFGT | AF000372.1 | Forward | TCAGGCGGAGGTCCTAGCACAT | 81 | 62.3 | 2.11 |
Reverse | GCCACGCTTTCCCACAATGAGT | |||||
ACT | XM_002282480.4 | Forward | GGCTGGATTTGCGGGTGATGAT | 80 | 61.5 | 1.97 |
Reverse | CCATGACACCAGTGTGCCTTGG | |||||
AIG1 | XM_002281960.4 | Forward | GCACGGCTGAAGGCAGAAGAGA | 104 | 62.4 | 1.99 |
Reverse | TCCGTCTCCCTCTGTGCTCTCT | |||||
GADPH | XM_002263109.3 | Forward | AGGCTGGAGAAGGCTGCTACCT | 139 | 62.4 | 1.89 |
Reverse | TGCTGGACCTGTTGTCACCGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peña-Neira, A.; Cortiella, M.G.i.; Ubeda, C.; Pastenes, C.; Villalobos, L.; Contador, L.; Infante, R.; Gómez, C. Phenolic, Polysaccharides Composition, and Texture Properties during Ripening and Storage Time of New Table Grape Cultivars in Chile. Plants 2023, 12, 2488. https://doi.org/10.3390/plants12132488
Peña-Neira A, Cortiella MGi, Ubeda C, Pastenes C, Villalobos L, Contador L, Infante R, Gómez C. Phenolic, Polysaccharides Composition, and Texture Properties during Ripening and Storage Time of New Table Grape Cultivars in Chile. Plants. 2023; 12(13):2488. https://doi.org/10.3390/plants12132488
Chicago/Turabian StylePeña-Neira, Alvaro, Mariona Gil i Cortiella, Cristina Ubeda, Claudio Pastenes, Luís Villalobos, Loreto Contador, Rodrigo Infante, and Camila Gómez. 2023. "Phenolic, Polysaccharides Composition, and Texture Properties during Ripening and Storage Time of New Table Grape Cultivars in Chile" Plants 12, no. 13: 2488. https://doi.org/10.3390/plants12132488