Genotypic Variation of Purple Rice in Response to Shading in Yield, Anthocyanin Content, and Gene Expression
Abstract
1. Introduction
2. Results
2.1. Yield and Yield Components
2.2. Total Anthocyanin and Total Chlorophyll Content
2.3. Expression of OsDFR
3. Discussion
4. Materials and Methods
4.1. Expression of OsDFR
4.2. Yield Measurement and Sample Preparation
4.3. Determination of Total Anthocyanin Content
4.4. Determination of Total Chlorophyll Content
4.5. Gene Expression of OsDFR
4.5.1. RNA Extraction
4.5.2. cDNA Synthesis
4.5.3. Gene Expression via Semi-Quantitative RT-PCR Analysis
4.5.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fongfon, S.; Pusadee, T.; Prom-u-thai, C.; Rerkasem, B.; Jamjod, S. Diversity of Purple Rice (Oryza sativa L.) Landraces in Northern Thailand. Agronomy 2021, 11, 2029. [Google Scholar] [CrossRef]
- Yamuangmorn, S.; Prom-U-Thai, C. The Potential of High-Anthocyanin Purple Rice as a Functional Ingredient in Human Health. Antioxidants 2021, 10, 833. [Google Scholar] [CrossRef] [PubMed]
- Khoo, E.H.; Azlan, A.; Tang, T.S.; Lim, M.S. Anthocyanidins and anthocyanins: Colored pigments as food, pharmaceutical ingredients, and the potential health benefits. Food Nutr. Res. 2017, 61, 1361779. [Google Scholar] [CrossRef] [PubMed]
- Landi, M.; Tattini, M.; Gould, K.S. Multiple functional roles of anthocyanins in plant-environment interactions. Environ. Exp. Bot. 2015, 119, 4–17. [Google Scholar] [CrossRef]
- Formisano, L.; Moreno, M.B.; Ciriello, M.; Zhang, L.; Pascale, D.S.; Lucini, L.; Rouphael, Y. Between Light and Shading: Morphological, Biochemical, and Metabolomics Insights into the Influence of Blue Photoselective Shading on Vegetable Seedlings. Front. Plant Sci. 2022, 13, 830. [Google Scholar] [CrossRef]
- Chen, Y.; Li, T.; Yang, Q.; Zhang, Y.; Zou, J.; Bian, Z.; Wen, X. UVA Radiation Is Beneficial for Yield and Quality of Indoor Cultivated Lettuce. Front. Plant Sci. 2019, 10, 1563. [Google Scholar] [CrossRef]
- Zoratti, L.; Sarala, M.; Carvalho, E.; Karppinen, K.; Martens, S.; Giongo, L.; Häggman, H.; Jaakola, L. Monochromatic light increases anthocyanin content during fruit development in bilberry. BMC Plant Biol. 2014, 14, 377. [Google Scholar] [CrossRef]
- Petrella, D.; Sessoms, B.F.; Watkins, E. Layering contrasting photo selective filters improves the simulation of foliar shade. Plant Methods 2022, 18, 16. [Google Scholar] [CrossRef]
- Li, Q.; Deng, F.; Chen, H.; Zeng, Y.; Li, B.; Zhong, X.; Wang, L.; Zhou, W.; Chen, Y.; Ren, W. Shading decreases rice yield by impeding grain-filling progress after heading. Agron. J. 2020, 112, 4018–4030. [Google Scholar] [CrossRef]
- Zhu, H.; Li, X.; Zhai, W.; Liu, Y.; Gao, Q.; Liu, J.; Ren, L.; Chen, H.; Zhu, Y. Effects of low light on photosynthetic properties, antioxidant enzyme activity, and anthocyanin accumulation in purple pak-choi (Brassica campestris ssp. Chinensis Makino). PLoS ONE 2017, 12, e0179305. [Google Scholar] [CrossRef]
- Syam’un, M.; Musa, Y.K.; Sadimantara, R.G.; Leomo, S.U.; Rakian, C.T. Shading effect on generative characters of upland red rice of Southeast Sulawesi, Indonesia. IOP Conf. Ser. Earth Environ. Sci. 2018, 157, 012017. [Google Scholar]
- Yamuangmorn, S.; Jumrus, S.; Jamjod, S.; Sringarm, K.; Arjin, C.; Prom-u-thai, C. Responses of purple rice variety to light intensities and soil zinc application on plant growth, yield and bioactive compounds synthesis. J. Cereal Sci. 2022, 106, 103495. [Google Scholar] [CrossRef]
- Naing, A.H.; Kim, C.K. Abiotic stress-induced anthocyanins in plants: Their role in tolerance to abiotic stresses. Physiol. Plant. 2021, 172, 1711–1723. [Google Scholar] [CrossRef]
- Enaru, B.; Dretcanu, G.; Pop, D.T.; Stǎnilǎ, A.; Diaconeasa, Z. Anthocyanins: Factors Affecting Their Stability and Degradation. Antioxidants 2021, 10, 1967. [Google Scholar] [CrossRef]
- Diaconeasa, Z.; Stirbu, I.; Xiao, J.; Leopold, N.; Ayvaz, Z.; Danciu, C.; Ayvaz, H.; Stǎnilǎ, A.; Nistor, M.; Socaciu, C. Anthocyanins, Vibrant Color Pigments, and Their Role in Skin Cancer Prevention. Biomedicines 2020, 8, 336. [Google Scholar] [CrossRef]
- Liu, H.; Liu, Z.; Wu, Y.; Zheng, L.; Zhang, G. Regulatory Mechanisms of Anthocyanin Biosynthesis in Apple and Pear. Int. J. Mol. Sci. 2021, 22, 8441. [Google Scholar] [CrossRef]
- Kim, M.-K.; Kim, H.-A.; Koh, K.; Kim, H.-S.; Lee, Y.S.; Kim, Y.H. Identification and quantification of anthocyanin pigments in colored rice. Nutr. Res. Pr. 2008, 2, 46–49. [Google Scholar] [CrossRef]
- Khan, A.; Jalil, S.; Cao, H.; Tsago, Y.; Sunusi, M.; Chen, Z.; Shi, C.; Jin, X. The Purple Leaf (pl6) Mutation Regulates Leaf Color by Altering the Anthocyanin and Chlorophyll Contents in Rice. Plants 2020, 9, 1477. [Google Scholar] [CrossRef]
- Choudhury, B.I.; Khan, M.L.; Dayanandan, S. Patterns of nucleotide diversity and phenotypes of two domestication related genes (OsC1 and Wx) in indigenous rice varieties in Northeast India. BMC Genet. 2014, 15, 71. [Google Scholar] [CrossRef]
- Meng, L.; Qi, C.; Wang, C.; Wang, S.; Zhou, C.; Ren, Y.; Cheng, Z.; Zhang, X.; Guo, X.; Zhao, Z.; et al. Determinant Factors and Regulatory Systems for Anthocyanin Biosynthesis in Rice Apiculi and Stigmas. Rice 2021, 14, 37. [Google Scholar] [CrossRef]
- Furukawa, T.; Maekawa, M.; Oki, T.; Suda, I.; Iida, S.; Shimada, H.; Takamure, I.; Kadowaki, K.-I. The Rc and Rd genes are involved in proanthocyanidin synthesis in rice pericarp. Plant J. 2006, 49, 91–102. [Google Scholar] [CrossRef] [PubMed]
- Jaakola, L.; Määttä, K.; Pirttilä, A.M.; Törrönen, R.; Kärenlampi, S.; Hohtola, A. Expression of genes involved in anthocyanin biosynthesis in relation to anthocyanin, proanthocyanidin, and flavonol levels during bilberry fruit development. Plant Physiol. 2002, 130, 729–739. [Google Scholar] [CrossRef] [PubMed]
- Ithal, N.; Reddy, A.R. Rice flavonoid pathway genes, OsDfr and OsAns, are induced by dehydration, high salt and ABA, and contain stress responsive promoter elements that interact with the transcription activator, OsC1-MYB. Plant Sci. 2004, 166, 1505–1513. [Google Scholar] [CrossRef]
- Tian, J.; Chen, M.-C.; Zhang, J.; Li, K.-T.; Song, T.-T.; Zhang, X.; Yao, Y.-C. Characteristics of dihydroflavonol 4-reductase gene promoters from different leaf colored Malus crabapple cultivars. Hortic. Res. 2017, 4, 17070. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Liu, M.; Lu, J.; Yang, H. Effects of shading on the growth and leaf photosynthetic characteristics of three forages in an apple orchard on the Loess Plateau of eastern Gansu, China. PeerJ 2019, 7, e7594. [Google Scholar] [CrossRef]
- Deng, F.; Wang, L.; Pu, L.S.; Mei, F.X.; Li, X.S.; Li, P.Q.; Ren, J.W. Shading stress increases chalkiness by postponing caryopsis development and disturbing starch characteristics of rice grains. Agric. For. Meteorol. 2018, 263, 49–58. [Google Scholar] [CrossRef]
- Cheng, F.; Bin, S.; Iqbal, A.; He, L.; Wei, S.; Zheng, H.; Yuan, P.; Liang, H.; Ali, I.; Xie, D.; et al. High Sink Capacity Improves Rice Grain Yield by Promoting Nitrogen and Dry Matter Accumulation. Agronomy 2022, 12, 1688. [Google Scholar] [CrossRef]
- Cantagallo, J.; Medan, D.; Hall, A. Grain number in sunflower as affected by shading during floret growth, anthesis and grain setting. Field Crop. Res. 2004, 85, 191–202. [Google Scholar] [CrossRef]
- Cruz, P.; Sierra, J.; Wilson, R.J.; Dulormne, M.; Tournebize, R. Effects of Shade on the Growth and Mineral Nutrition of Tropical Grasses in Silvopastoral Systems. Ann. Arid Zone 1999, 38, 335–361. [Google Scholar]
- Shoeva, Y.O.; Gordeeva, I.E.; Klhestkina, E.K. The Regulation of Anthocyanin Synthesis in the Wheat Pericarp. Molecules 2014, 19, 20266–20279. [Google Scholar] [CrossRef]
- Fukuoka, S.; Yamamoto, S.-I.; Mizobuchi, R.; Yamanouchi, U.; Ono, K.; Kitazawa, N.; Yasuda, N.; Fujita, Y.; Nguyen, T.T.T.; Koizumi, S.; et al. Multiple functional polymorphisms in a single disease resistance gene in rice enhance durable resistance to blast. Sci. Rep. 2014, 4, 4550. [Google Scholar] [CrossRef]
- Xia, D.; Zhou, H.; Wang, Y.; Li, P.; Fu, P.; Wu, B.; He, Y. How rice organs are colored: The genetic basis of anthocyanin biosynthesis in rice. Crop J. 2021, 9, 598–608. [Google Scholar] [CrossRef]
- Zheng, J.; Wu, H.; Zhu, H.; Huang, C.; Liu, C.; Chang, Y.; Kong, Z.; Zhou, Z.; Wang, G.; Lin, Y.; et al. Determining factors, regulation system, and domestication of anthocyanin biosynthesis in rice leaves. New Phytol. 2019, 223, 705–721. [Google Scholar] [CrossRef]
- Pourcel, L.; Irani, N.G.; Koo, A.J.K.; Bohorquez-Restrepo, A.; Howe, G.A.; Grotewold, E. A chemical complementation approach reveals genes and interactions of flavonoids with other pathways. Plant J. 2013, 74, 383–397. [Google Scholar] [CrossRef]
- Wang, H.; Fan, W.; Li, H.; Yang, J.; Huang, J.; Zhang, P. Functional characterization of Dihydroflavonol-4-reductase in anthocyanin biosynthesis of purple sweet potato underlies the direct evidence of anthocyanins function against abiotic stresses. PLoS ONE 2013, 8, e78484. [Google Scholar] [CrossRef]
- Katsuhiro, M.; Suzuki, R.; Tsuchiya, W.; Inagaki, N.; Yamazaki, T.; Hisano, T.; Yasui, Y.; Komori, T.; Koshio, M.; Kubota, S.; et al. A new buckwheat dihydroflavonol 4-reductase (DFR), with a unique substrate binding structure, has altered substrate specificity. BMC Plant Biol. 2017, 17, 239. [Google Scholar] [CrossRef]
- Lina, M.B.; Robert, V.; Peter, G.L.; Klinkhamer; Choi, H.Y. Thin-Layer Chromatography Metabolomics. In Encyclopedia of Analytical Science; Elsevier: Amsterdam, The Netherlands, 2019; pp. 59–75. [Google Scholar]
- Zheng, T.; Tan, W.; Yang, H.; Zhang, L.; Li, T.; Liu, B.; Zhang, D. Regulation of anthocyanin accumulation via MYB75/HAT1/TPL-mediated transcriptional repression. PLoS Genet. 2019, 15, e1007993. [Google Scholar] [CrossRef]
- Abdel, A.; Hucl, P. A rapid method for quantifying total anthocyanins in blue aleurone and purple pericarp wheats. Cereal Chem. 1999, 76, 350–354. [Google Scholar] [CrossRef]
- Sakulsingharoj, C.; Inta, P.; Sukkasem, R.; Pongjaroenkit, S.; Chowpongpang, S.; Sangtong, V. Overexpression of OSB2 gene in transgenic rice up-regulated expression of structural genes in anthocyanin biosynthesis pathway. Thai J. Genet. 2014, 7, 173–182. [Google Scholar]
- Yamaji, N.; Ma, J.F. A Transporter at the Node Responsible for Intervascular Transfer of Silicon in Rice. Plant Cell 2009, 21, 2878–2883. [Google Scholar] [CrossRef]
No. of Tillers Plant−1 | No. of Panicles Plant−1 | No. of Spikelets Panicle−1 | Panicle Length (cm) | Culm Length (cm) | |
---|---|---|---|---|---|
Shading treatment | |||||
No shading | 6.51 ± 0.27 | 5.96 ± 0.26 | 118.63 ± 0.24 | 24.65 ± 0.35 | 86.72 ± 1.66 AB |
30% | 6.42 ± 0.28 | 5.81 ± 0.28 | 118.93 ± 0.23 | 24.29 ± 0.34 | 87.10 ± 1.65 A |
50% | 6.28 ± 0.26 | 5.76 ± 0.29 | 119.06 ± 0.24 | 24.71 ± 0.31 | 84.25 ± 1.66 C |
70% | 6.25 ± 0.27 | 5.63 ± 0.28 | 119.24 ± 0.25 | 24.83 ± 0.32 | 85.40 ± 1.64 BC |
Variety | |||||
KJ CMU-107 | 6.53 ± 0.21 B | 6.25 ± 0.22 B | 98.57 ± 0.23 D | 24.14 ± 0.33 B | 121.98 ± 1.81 A |
K2 | 8.23 ± 0.19 A | 7.58 ± 0.23 A | 140.97 ± 0.25 A | 25.65 ± 0.34 A | 71.07 ± 1.85 D |
K4 | 4.93 ± 0.21 C | 4.33 ± 0.22 D | 122.08 ± 0.23 B | 25.23 ± 0.33 A | 74.18 ± 1.82 C |
KDK10 | 6.43 ± 0.22 B | 5.72 ± 0.21 C | 113.97 ± 0.24 C | 23.39 ± 0.32 C | 76.23 ± 1.81 B |
F-test | |||||
Shading treatment (S) | ns | ns | ns | ns | * |
LSD0.05 (S) | 1.65 | ||||
Variety (V) | *** | *** | *** | *** | *** |
LSD0.05 (V) | 0.42 | 0.45 | 0.48 | 0.63 | 1.81 |
SxV | ns | ns | ns | ns | ns |
Gene | Primer Names and Sequences (5′➜3′) | References |
---|---|---|
OsDFR | OsDFRF: CGGGTTCAGGTTCAGGTACA | [40] |
OsDFRR: TGAAACCGGAGGGAGTAAC | [40] | |
OsActin | OsActinF: GACTCTGGTGATGGTGTCAGC | [41] |
OsActinR: GGCTGGAAGAGGACCTCAGG | [41] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Danpreedanan, N.; Yamuangmorn, S.; Jamjod, S.; Prom-u-thai, C.; Pusadee, T. Genotypic Variation of Purple Rice in Response to Shading in Yield, Anthocyanin Content, and Gene Expression. Plants 2023, 12, 2582. https://doi.org/10.3390/plants12132582
Danpreedanan N, Yamuangmorn S, Jamjod S, Prom-u-thai C, Pusadee T. Genotypic Variation of Purple Rice in Response to Shading in Yield, Anthocyanin Content, and Gene Expression. Plants. 2023; 12(13):2582. https://doi.org/10.3390/plants12132582
Chicago/Turabian StyleDanpreedanan, Nantapat, Supapohn Yamuangmorn, Sansanee Jamjod, Chanakan Prom-u-thai, and Tonapha Pusadee. 2023. "Genotypic Variation of Purple Rice in Response to Shading in Yield, Anthocyanin Content, and Gene Expression" Plants 12, no. 13: 2582. https://doi.org/10.3390/plants12132582
APA StyleDanpreedanan, N., Yamuangmorn, S., Jamjod, S., Prom-u-thai, C., & Pusadee, T. (2023). Genotypic Variation of Purple Rice in Response to Shading in Yield, Anthocyanin Content, and Gene Expression. Plants, 12(13), 2582. https://doi.org/10.3390/plants12132582