Next Article in Journal
Metabolomics Revealed the Tolerance and Growth Dynamics of Arbuscular Mycorrhizal Fungi (AMF) to Soil Salinity in Licorice
Previous Article in Journal
Virus-Induced galactinol-sucrose galactosyltransferase 2 Silencing Delays Tomato Fruit Ripening
Previous Article in Special Issue
Genome-Wide Analysis of the Nramp Gene Family in Kenaf (Hibiscus cannabinus): Identification, Expression Analysis, and Response to Cadmium Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 18
10.3390/plants13182653
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phenotypic Analysis and Gene Cloning of Rice Floury Endosperm Mutant wcr (White-Core Rice)

by
Yihao Yang
1,2,
Xiaoyi Yang
1,
Lingjun Wu
1,
Zixing Sun
1,
Yi Zhang
1,
Ziyan Shen
1,
Juan Zhou
1,2,
Min Guo
1,2 and
Changjie Yan
1,2,*
1
Jiangsu Key Laboratory of Crop Genomics and Molecular Breeding/Zhongshan Biological Breeding Laboratory/Key Laboratory of Plant Functional Genomics of the Ministry of Education, Agricultural College, Yangzhou University, Yangzhou 225009, China
2
Jiangsu Co-Innovation Center for Modern Production Technology of Grain Crops/Jiangsu Key Laboratory of Crop Genetics and Physiology, Yangzhou University, Yangzhou 225009, China
*
Author to whom correspondence should be addressed.
Plants 2024, 13(18), 2653; https://doi.org/10.3390/plants13182653
Submission received: 18 August 2024 / Revised: 18 September 2024 / Accepted: 21 September 2024 / Published: 22 September 2024
(This article belongs to the Special Issue Crop Functional Genomics and Biological Breeding)
Browse Figures
Review Reports Versions Notes

Abstract

:
The composition and distribution of storage substances in rice endosperm directly affect grain quality. A floury endosperm mutant, wcr (white-core rice), was identified, exhibiting a loose arrangement of starch granules with a floury opaque appearance in the inner layer of mature grains, resulting in reduced grain weight. The total starch and amylose content remained unchanged, but the levels of the four component proteins in the mutant brown rice significantly decreased. Additionally, the milled rice (inner endosperm) showed a significant decrease in total starch and amylose content, accompanied by a nearly threefold increase in albumin content. The swelling capacity of mutant starch was reduced, and its chain length distribution was altered. The target gene was mapped on chromosome 5 within a 65 kb region. A frameshift mutation occurred due to an insertion of an extra C base in the second exon of the cyOsPPDKB gene, which encodes pyruvate phosphate dikinase. Expression analysis revealed that wcr not only affected genes involved in starch metabolism but also downregulated expression levels of genes associated with storage protein synthesis. Overall, wcr plays a crucial role as a regulator factor influencing protein synthesis and starch metabolism in rice grains.

1. Introduction

Rice (Oryza sativa L.) is a crucial staple crop worldwide, and the advancements in dwarf breeding during the 1960s, as well as the theoretical and technical breakthroughs in hybrid rice breeding during the 1970s, have significantly improved rice production in China, effectively addressing food scarcity issues [1]. With an improvement in living standards, there has been an increasing demand among consumers for higher rice grain quality. Starch and protein are the primary storage substances within the endosperm of rice grains. Starch constitutes a majority portion that determines both grain quality and yield, followed by protein content which influences rice palatability and nutritional value [2,3]. Therefore, it is of immense significance to comprehensively analyze regulatory mechanisms governing starch and protein synthesis as well as accumulation while exploring associated genes to enhance rice grain quality.
The rice floury endosperm mutants are valuable genetic resources for studying the complex networks involved in endosperm development and quality regulation due to their abnormal synthesis and accumulation of starch or storage proteins, resulting in floury and opaque endosperms. Currently, a multitude of genes associated with floury endosperm mutants have been successfully cloned, encompassing diverse aspects of cellular metabolic processes including starch synthesis and sucrose metabolism, amyloplastic development, energy supply, glycolytic metabolism, protein processing and transport, lipid transport, epigenetics, transcriptional regulation, and protein interaction (Table 1). The cloning and molecular mechanism analysis of the aforementioned genes provide a theoretical foundation for understanding starch and protein synthesis, as well as the biochemical metabolic pathways in rice. This enhances our knowledge of endosperm development regulation and offers the potential for improving rice quality through genetic engineering.
The synthesis and transportation of storage substances in cereal grain endosperm require sufficient energy supply [53]. However, the low oxygen environment within the endosperm hampers oxidative phosphorylation, thereby limiting ATP production [54,55]. The glycolytic pathway serves as a crucial means for biological organisms to generate energy under anaerobic conditions, with pyruvate kinase (PK) and pyruvate phosphate dikinase (PPDK) catalyzing this reaction [56,57]. In plants, PPDK can be classified into chloroplast chPPDK and cytosolic cyPPDK. ChPPDK is primarily found in chloroplasts and expressed predominantly in photosynthetic tissues such as leaves of C4 plants. Conversely, cyPPDK is mainly localized within the cytoplasm and expressed in non-photosynthetic tissues like grains and roots [58]. In rice, there are only two genes encoding PPDK: one encodes OsPPDKA while another produces two transcripts of C4-type chloroplastic chOsPPDKB and cytosolic cyOsPPDKB [24]. CyOsPPDKB is responsible for the reversible conversion of pyruvate and inorganic phosphate (Pi) into phosphoenolpyruvate (PEP) and inorganic pyrophosphate (PPi), which can serve as an alternative phosphate donor for ATP in plant cells [24,59,60,61]. This process provides essential carbon skeletons for amino acid and lipid biosynthesis, directly influencing ADP-glucose allocation towards starch and lipids [24,62,63,64,65,66,67,68].
In this study, we identified a white-core endosperm mutant (wcr) derived from the rice variety Sasanishiki through tissue culture. We present a comprehensive investigation of the starch morphology, physicochemical properties, and protein composition content of the grains. Additionally, we precisely mapped the mutant gene and explored its involvement in regulating the network that governs rice grain starch and storage protein content. This research contributes valuable genetic resources and provides a theoretical foundation for unraveling mechanisms underlying rice endosperm development and grain quality regulation.

2. Results

2.1. Analysis of Phenotypic and Crop Traits of the wcr Mutant

The wcr mutant was derived from the Japonica rice variety Sasanishiki through plant tissue culture. Overall, there were minimal changes in the plant architecture of the wcr mutant (Figure 1A). Upon hull removal, the mature grain of the wcr mutant exhibits a starchy and translucent state, with opaqueness primarily localized in the inner endosperm (Figure 1B,C). The starch granules in the endosperm of wild-type exhibited a tightly and evenly arranged pattern in both inner and outer layers under electron microscope scanning (Figure 1D). In contrast, the starch granules in wcr’s endosperm showed a loosely arranged structure with larger inter-granular gaps and an increased presence of single-grain type starch granules within the inner layer (Figure 1D). The mutant showed significantly increased plant height, grain length, and width compared to the wild type (Figure 1A,E,G,H), while exhibiting a significant decrease in tiller number, grain thickness, and thousand-grain weight (Figure 1F,I,J).

2.2. Physicochemical Characteristics of Mature Grains of wcr Mutant

The physicochemical properties of brown rice and milled rice from the wcr mutant were further investigated in comparison to those of the wild type, due to its abnormal endosperm development and significant differences observed in starch granule structure between the inner and outer layers (Figure 1B–D). No significant differences were observed in the total starch content and amylose content of brown rice flour between wcr and wild type (Figure 2A,B). However, both traits showed a significant decrease when analyzing milled rice flour (Figure 2A,B). Based on these results, the total starch content and amylose content in the peripheral endosperm of wcr significantly increased compared to the wild type (Figure 2H). The analysis of storage proteins showed a significant decrease in all four component proteins (albumin, globulin, prolamin, and glutelin) in mutant brown rice flour (Figure 2C–F). However, apart from a nearly threefold increase in the content of albumin compared to the wild type (Figure 2C), there is no difference in the protein content of the other three components when analyzed in milled rice flour (Figure 2D–F). These changes were also reflected in the SDS-PAGE analysis of storage proteins (Figure 2G). It can be inferred that unlike the changing trends of total starch content and amylose content in the wcr peripheral endosperm, protein contents for all four components significantly decrease compared to the wild-type with albumin showing the largest decrease (Figure 2H).

2.3. Gelatinization Characteristics and Amylopectin Structure Analysis of wcr

Although the total starch content and amylose content in the brown rice flour of the mutant did not show significant differences compared to those of the wild type (Figure 2A,B), results from starch gelatinization tests using varying concentrations of urea solution revealed that the wcr mutant exhibited reduced solubility in urea. As shown in Figure 3A,B, the swelling volume of the mutant’s brown rice flour was smaller than that of the wild-type under different urea concentrations, with a noticeable difference observed at a concentration of 1 mol/L (Figure 3B). At a urea concentration of 8 mol/L, no expansion was observed for the mutant while it continued for the wild type (Figure 3A,B). Furthermore, the analysis of the amylopectin chain length distribution revealed a reduction in the content of chain lengths ranging from 6 to 35 in the degree of polymerization (DP) in the brown rice flour of the wcr mutant, while an increase was observed in the chain lengths greater than 36 DP (Figure 3C).

2.4. Genetic Analysis of the wcr Mutant

The wcr mutant was crossed with the background Sasanishiki, resulting in F1 plants with normal grain development. In the subsequent F2 population, segregation occurred between plants with normal endosperm and those with floury endosperm. A random survey of 232 F2 plants showed that 177 had normal phenotypes, while 55 had mutant phenotypes. The observed segregation pattern of 3:1 (x2 = 0.143 < 3.84) in the F2 population suggests that the wcr mutant is governed by a pair of recessive nuclear genes.

2.5. Fine Mapping of the wcr Gene

We successfully mapped the wcr gene to chromosome 5 at approximately 5.41 Mb (19,268,954 bp–24,757,870 bp) physical interval using MutMap analysis (Figure 4A). To further fine-map the wcr gene, we crossed the wcr mutant with the single-segment substitution line SL418 [69], resulting in an F2 population of 2074 plants. From this population, we selected 108 plants with floury endosperm and narrowed down the location of the target gene within a 76 kb region delimited by markers C5.8 and C5.9 (Table 2, Figure 4B), which encompasses eight ORFs. Among these ORFs, LOC_Os05g33570 encoding a functional pyruvate phosphate dikinase OsPPDKB was found to be allelic to the flo4 gene [24] (Figure 4C). Sequencing results revealed a frameshift mutation caused by an insertion of an additional base C into the second exon of cyOsPPDKB (Figure 4D). Therefore, wcr represents a novel allelic variation of flo4.

2.6. Gene Expression Analysis of Storage Substance-Related Genes

Considering the alterations in storage substances (starch and protein) composition and distribution in the wcr mutant (Figure 2), we conducted a comprehensive investigation into the expression levels of 35 genes involved in grain protein synthesis and 18 genes associated with starch metabolism in both wild type and mutant rice. As shown in Figure 5, the expression levels of most rice protein synthesis genes in the mutant were significantly reduced (Figure 5A), while the expression levels of starch metabolism-related genes exhibited varying degrees of downregulation, but the overall magnitude was small (Figure 5B).

3. Discussion

Through gene mapping and sequencing comparison, it has been determined that the wcr mutant is governed by a pair of recessive nuclear genes encoding pyruvate phosphate dikinase OsPPDKB. A comprehensive literature search has identified a total of nine distinct allelic mutant genes for OsPPDKB, including knockout mutations (flo4-1 [24], flo4-2 [24], flo4-3 [24], and flo4-303 [63]) and missense mutations (flo4-4 [64], flo4-5 [65], flo4-6 [66], M14 [67], and floTR1 [68]) (Figure 6). The wcr mutation in this study was caused by an additional C base insertion in the second exon of cyOsPPDKB, resulting in a frameshift mutation. Therefore, the wcr can be considered as a novel allelic gene variant of cyOsPPDKB. Although there have been some changes in the crop traits of wcr, such as increased plant height and reduced tillering, which differ from previous studies, it should be noted that the wcr mutant originated from plant tissue culture, where stable heritable variations were likely generated during the process.
The 10 identified mutants exhibit a similar floury endosperm phenotype but show significant variation in the physicochemical properties of rice flour, including amylose content, protein content, and amylopectin structure. In terms of amylose content, most allelic mutant grains show a significant reduction ranging from 13% to 46%, with flo4-4 showing a 5% significant increase and flo4-5 having no impact on amylose levels [24,63,64,65,66,67,68]. Interestingly, while the total starch and amylose content in the brown rice of the wcr mutant was similar to those of the wild type, there was a significant decrease observed in milled rice (Figure 2A,B). Regarding total protein content, flo4-1, flo4-2, and floTR1 mutant grains showed an increase ranging from 5% to 16%, while flo4-4 and flo4-5 alleles resulted in a decrease of more than 15% [24,65]. No effect on protein was observed for M14 rice grains [67]. Notably, the levels of four component proteins were significantly reduced in the wcr mutant brown rice; however, apart from a notable increase in albumin content observed for milled rice (Figure 2C–F), minimal changes were seen for the other three component proteins. The analysis of amylopectin structure revealed that both floTR1 and M14 grains contained fewer short chains (DP < 16) but more middle-length chains (DP > 18) [67,68], which diverged from our study’s findings. In contrast, the wcr mutant showed fewer middle-length chains (DP < 36) but more long chains (DP > 36) (Figure 3C). In summary, different allelic mutations of cyOsPPDKB resulted in significant changes in the content and distribution of rice storage substances across various genetic backgrounds; however, these changes were not entirely consistent. We propose that the diverse physicochemical properties observed among different allelic mutants of cyOsPPDKB may be attributed to several potential factors. Firstly, distinct allelic variants of cyOsPPDKB may generate varying protein functionalities; however, further confirmation through molecular genetic experiments is required for validation. Secondly, dissimilar genetic backgrounds among the mutants are likely to contribute to the observed differences in physicochemical properties, which could be influenced by combined effects with other genes within the genome. Therefore, future investigations can explore utilizing CRISPR/Cas9 technology to generate saturated mutations of cyOsPPDKB within a consistent genetic background and fully elucidate its molecular functions.
The distinguishing feature of the OsPPDK mutant, compared to other mutants with rice floury endosperm, is its translucent periphery and internal flouriness. In this study, the arrangement of amyloplasts in the inner endosperm and peripheral regions of wcr grains was observed using scanning electron microscopy. It was found that internal amyloplasts had a loose structure with larger pores, while external ones were densely packed (Figure 1D). The reasons for this phenomenon may be as follows: (1) Previous research has shown that OsPPDKB plays a compensatory role in ATP deficiency under anaerobic conditions [24,57,58,59,60,61]. In normal rice grains, the level of hypoxia is more severe in the inner endosperm than in the peripheral region. When there is a mutation in OsPPDKB and it loses its ability to convert pyruvate and inorganic phosphate (PI) into phosphoenolpyruvate (PEP) and inorganic pyrophosphate (PPI), which can serve as an alternative phosphate donor for ATP production [24,57,58,59,60,61], substance transport within the inner endosperm is disrupted, leading to poor endosperm development. However, there is an improvement in aerobic conditions within the grain peripheral region, likely providing sufficient energy for material transport through other oxidative phosphorylation pathways, resulting in relatively normal development. (2) The expression of cyOsPPDKB in rice grains peaks at 10 days after flowering, followed by a rapid decrease in protein level and activity through threonyl-phosphorylation and protein degradation mechanisms around approximately 20 days after anthesis [61]. This suggests that cyOsPPDKB likely plays a crucial role during the initial 20-day period of grain filling, which coincides with the accumulation of storage substances from the central region to the periphery of the endosperm [70]. Therefore, cyOsPPDKB’s temporal and spatial expression pattern is likely associated with severe flouriness in the inner endosperm and light flouriness in the outer part. However, these reasons are speculative hypotheses and require rigorous scientific experiments for validation.
With the diversification in dietary habits and rapid economic development, rice-processing products like rice cakes, noodles, crackers, and wine have become increasingly popular. Compared to regular rice cultivars, floury mutants with loosely packed starch granules are particularly useful for dry-milled flour production or sake brewing due to their easily breakable soft endosperm, finer particle size and less damaged starch, and strong water absorption properties [71]. For example, South Korea has developed new floury rice varieties such as suweon542 [72], Hangaru [73], Shingil [74], and Garumi2 [71] in recent years, which successfully reduced the rice milling cost. In this study, the starch granules of wcr endosperm were also loosely arranged, providing new genetic material for breeding low milling cost rice material. Additionally, previous research has shown that the spatial distribution and characteristics of protein content and composition in Japonica rice grains play a crucial role in determining the taste quality of sake [75]. In this study, the total protein content and component protein content in the wcr mutant brown rice were significantly reduced, accompanied by alterations in the distribution of different components. These findings highlight its potential as a valuable germplasm resource for further research aimed at enhancing sake quality.

4. Materials and Methods

4.1. Experimental Materials and Field Design

The experimental materials utilized in this study included a rice endosperm mutant wcr obtained through plant tissue culture, the parental variety Sasanishiki as the background control, an F2 segregating population derived from crossing wcr with Sasanishiki for MutMap analysis, and an F2 population obtained by crossing wcr with single-segment substitution line SL418 [69] for precise gene mapping. Each genotype was individually planted with 10 plants per row. The spacing between plants was maintained at 20 cm × 20 cm. Standardized water and fertilizer management practices were followed.

4.2. Main Crop Characteristics of Rice Plants

The main panicles of 5 mutants and 5 wild-type rice plants were selected at the mature stage for the investigation of height, tiller, grain length, grain width, and 1000-grain weight. The grain length and width of 5 mutants and 5 wild-type rice grains were analyzed using a seed-measuring instrument (Model SC-G, Wanshen, Hangzhou, China).

4.3. Scanning Electron Microscopy Analysis

The mature grains were transversely cut by a knife, coated with gold, and examined under a scanning electron microscope (SEM, S-4800, Hitachi, Tokyo, Japan). For the observation of compound starch granules, transverse sections of WT and wcr mature grains were fixed overnight in 2% (v/v) glutaraldehyde (CAS: P1126, Solarbio, Beijing, China). The samples were dehydrated in an alcohol series, embedded in LR White resin (Heraeus Kulzer, Wehrheim, Germany), and sectioned using an ultrathin microtome (EM UC7, Leica, Wetzlar, Germany). Semi-thin sections were dried at 40 °C, stained with I2-KI solution for visualization purposes, and observed using a light microscope (BX53 Olympus, Tokyo, Japan).

4.4. Protein Extraction and SDS-PAGE Analysis

The four kinds of storage protein were extracted from the floury grains of 3 mutants and 3 wild-type rice grains as described previously [76], and the protein content of each component was quantified by means of the Bradford assay [77]. SDS-PAGE and protein gel blot analysis were performed as described previously [78].

4.5. Analysis of the Amylose and Total Starch Contents

The total starch content of 3 mutants and 3 wild-type rice grains was measured using a Megazyme Inc. kit (Bray, Ireland) following the procedure provided by the manufacturer. The apparent amylose content of 3 mutants and 3 wild-type rice grains was measured using the iodine colorimetric method [79].

4.6. Determination of Chain Length of Amylopectin

Starch (10 mg) was dissolved in 5 mL water in a water bath (100 °C) for 60 min; 10 microliters (μL) of sodium azide solution (2% w/v) (CAS: 26628-22-8, Anpel, Shanghai, China), 50 μL acetate buffer (0.6 M, pH 4.4) (CAS: 127-09-3, Anpel, China), and 10 μL isoamylase (1400 U) (08124, Sigma, Darmstadt, Germany) were added to the starch dispersion, and the mixture was incubated in a water bath at 37 °C for 24 h. The hydroxyl groups of the debranched glucans were reduced by treatment with 0.5% (w/v) of sodium borohydride (16940-66-2, Sigma, Germany) under alkaline conditions for 20 h. The preparation of about 600 μL was dried in a vacuum at room temperature and allowed to dissolve in 30 μL of 1 M NaOH (16940-66-2, Anpel, China) for 60 min. Then, the solution was diluted with 570 μL of distilled water.
The sample extracts were analyzed by high-performance anion-exchange chromatography (HPAEC) on a CarboPac PA-200 anion-exchange column (4.0 × 250 mm; Dionex, Sunnyvale, CA, USA) using a pulsed amperometric detector (PAD; Dionex ICS 5000 system): flow rate, 0.4 mL/min; injection volume, 5 μL; solvent system, 0.2 M NaOH: (0.2 M NaOH, 0.2 M NaAc); gradient program, 90:10 v/v at 0 min, 90:10 v/v at 10 min, 40:60 v/v at 30 min, 40:60 v/v at 50 min, 90:10 v/v at 50.1 min, 90:10 v/v at 60 min.
Data were acquired on the ICS5000 (Thermo Scientific, Waltham, MA, USA) and processed using chromeleon 7.2 CDS (Thermo Scientific). Quantified data were output into Excel format.

4.7. Genome Mapping of the wcr Locus

To clone the wcr gene, the wcr mutant was used as the parent for a cross with the background Sasanishiki to produce an F2 population. In the F2 population, we selected 20 plants that showed wcr phenotypes and pooled their DNA in an equal ratio for whole-genome resequencing using NextSeq 500 (Illumina, San Diego, CA, USA, http://www.illumina.com/). The MutMap was performed according to a previous study [80]. To further fine-mapping the wcr gene, we crossed the wcr mutant with the single-segment substitution line SL418 to create an F2 population of 2074 plants. By utilizing nine polymorphic markers, we successfully fine-mapped the target gene. The primers are listed in Table 2.

4.8. RNA Extraction, cDNA Preparation, and qRT-PCR

Total RNA was extracted from endosperm 15 days after flowering using an RNA extraction kit (Tiangen, Beijing, China). First-strand cDNA was synthesized using a reverse transcription kit (Vazyme, Nanjing, China). Quantitative reverse transcription (qRT-PCR) was performed with a CFX96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA) using an SYBR qPCR Master Mix (Vazyme, Nanjing, China). The PCR procedure was carried out using the following program: 95 °C for 10 min, then 40 cycles of 95 °C for 15 s, and 60 °C for 1 min. All assays were performed with at least three biological replicates; each biological study repeats the setup three times for technical replication. The rice actin gene served as the internal control to normalize gene expression. Quantitative gene expression was analyzed from three biological replicates by the 2−ΔΔCt method. The primers were used as described previously [76].

4.9. Data Analysis

The experiment was conducted with three biological replicates for each sample. Microsoft Excel 2016 was used for data collection, while the statistical analysis software SPSS 15.0 was used for variance analysis. All experimental data are presented as means ± SD.

Author Contributions

Y.Y. and C.Y. designed this research and analyzed the data; Z.S. (Zixing Sun), L.W., Y.Z., X.Y., Z.S. (Ziyan Shen), M.G. and J.Z. performed this research; Y.Y. and C.Y. wrote this manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Biological Breeding-National Science and Technology Major Project (2023ZD04068), the National Natural Science Foundation of China (32301827), the China Postdoctoral Science Foundation (2023M733005, 2024T170754), the programs of the Jiangsu Province Government (BK20210798, BE2022365-2, BE2022335, JBGS [2021]001, and BE2021334-1), the Project of Zhongshan Biological Breeding Laboratory (ZSBBL-KY2023-01), the Open Project Program (20240106) of State Key Laboratory of Rice Biology and Breeding, the Open Funds of the Jiangsu Key Laboratory of Crop Genomics and Molecular Breeding (PL202306), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAP).

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zheng, X.M.; Wei, F.; Cheng, C.; Qian, Q. A historical review of hybrid rice breeding. J. Integr. Plant Biol. 2024, 66, 532–545. [Google Scholar] [CrossRef] [PubMed]
  2. Ren, D.Y.; Ding, C.Q.; Qian, Q. Molecular bases of rice grain size and quality for optimized productivity. Sci. Bull. 2023, 68, 314–350. [Google Scholar] [CrossRef] [PubMed]
  3. Zhao, D.S.; Zhang, C.Q.; Li, Q.F.; Liu, Q.Q. Genetic control of grain appearance quality in rice. Biotechnol. Adv. 2022, 60, 108014. [Google Scholar] [CrossRef] [PubMed]
  4. Long, W.H.; Dong, B.N.; Wang, Y.H.; Pan, P.Y.; Wang, Y.L.; Liu, L.L.; Chen, X.L.; Liu, X.; Liu, S.J.; Tian, Y.L.; et al. FLOURY ENDOSPERM 8, encoding the UDP-glucose pyro phosphorylase 1, affects the synthesis and structure of starch in rice endosperm. J. Plant Biol. 2017, 60, 513–522. [Google Scholar] [CrossRef]
  5. Tsuneo, K.; Ryutaro, M.; Shinjiro, O.; Yu, W.; Naohiro, A.; Akira, H. Evaluation of alleles at OsAGPS2, OsAGPL2, and OsSUT1 related to grain filling in rice in a common genetic background. Crop Sci. 2020, 61, 1154–1167. [Google Scholar]
  6. Bilal, C.; Shota, S.; Aytug, T.; Hiroaki, M.; Ryosuke, S.; Salvinder, S.; Naoko, C.; Yuko, H.; Naoko, F.; Seon-Kap, H.; et al. Analysis of the Rice ADP-Glucose Transporter (OsBT1) Indicates the Presence of Regulatory Processes in the Amyloplast Stroma That Control ADP-Glucose Flux into Starch. Plant Physiol. 2016, 170, 1271–1283. [Google Scholar]
  7. Yang, R.F.; Sun, C.L.; Bai, J.J.; Luo, Z.X.; Shi, B.; Zhang, J.M.; Yan, W.G.; Piao, Z.Z. A Putative Gene sbe3-rs for Resistant Starch Mutated from SBE3 for Starch Branching Enzyme in Rice (Oryza sativa L.). PLoS ONE 2012, 7, e43026. [Google Scholar] [CrossRef]
  8. Ryoo, N.; Yu, C.; Park, C.; Baik, M.; Park, I.M.; Cho, M.; Bhoo, S.H.; An, G.; Hahn, T.; Jeon, J. Knockout of a starch synthase gene OsSSIIIa/Flo5 causes white-core floury endosperm in rice (Oryza sativa L.). Plant Cell Rep. 2007, 26, 1083–1095. [Google Scholar] [CrossRef]
  9. Satoh, H.; Shibahara, K.; Tokunaga, T.; Nishi, A.; Tasaki, M.; Hwang, S.; Okita, T.; Kaneko, N.; Fujita, N.; Yoshida, M.; et al. Mutation of the plastidial α-glucan phosphorylase gene in rice affects the synthesis and structure of starch in the endosperm. Plant Cell 2008, 20, 1833–1849. [Google Scholar] [CrossRef]
  10. Sun, L.; Yang, D.L.; Kong, Y.; Chen, Y.; Li, X.Z.; Zeng, L.J.; Li, Q.; Wang, E.T.; He, Z.H. Sugar homeostasis mediated by cell wall invertase GRAIN INCOMPLETE FILLING 1 (GIF1) plays a role in pre-existing and induced defence in rice. Mol. Plant Pathol. 2014, 15, 161–173. [Google Scholar] [CrossRef]
  11. Huang, L.C.; Sreenivasulu, N.; Liu, Q.Q. Waxy editing: Old meets new. Trends Plant Sci. 2020, 25, 963–966. [Google Scholar] [CrossRef] [PubMed]
  12. Wu, H.M.; Ren, Y.L.; Dong, H.; Xie, C.; Zhao, L.; Wang, X.; Zhang, F.L.; Zhang, B.L.; Jiang, X.K.; Huang, Y.S.; et al. FLOURY ENDOSPERM24, a heat shock protein 101 (HSP101), is required for starch biosynthesis and endosperm development in rice. New Phytol. 2024, 242, 2635–2651. [Google Scholar] [CrossRef] [PubMed]
  13. Matsushima, R.; Maekawa, M.; Kusano, M.; Kondo, H.; Fujita, N.; Kawagoe, Y.; Sakamoto, W. Amyloplast-Localized SUBSTANDARD STARCH GRAIN4 Protein Influences the Size of Starch Grains in Rice Endosperm. Plant Physiol. 2013, 164, 623–636. [Google Scholar] [CrossRef]
  14. Matsushima, R.; Maekawa, M.; Kusano, M.; Tomita, K.; Kondo, H.; Nishimura, H.; Crofts, N.; Fujita, N.; Sakamoto, W. Amyloplast Membrane Protein SUBSTANDARD STARCH GRAIN6 Controls Starch Grain Size in Rice Endosperm. Plant Physiol. 2016, 170, 1445–1459. [Google Scholar] [CrossRef]
  15. Yang, H.G.; Ren, Y.L.; Zhang, B.L.; Jin, J.; Du, F.L.; Shang, Z.Z.; Fu, Y.S.; Zhu, Y.; Wang, X.; Zhu, C.Y.; et al. SUBSTANDRAD STARCH GRAIN7 regulates starch grain size and endosperm development in rice. Plant Biotechnol. J. 2024, 1–15. [Google Scholar] [CrossRef]
  16. Long, W.H.; Wang, Y.L.; Zhu, S.S.; Jing, W.; Wang, Y.H.; Ren, Y.L.; Tian, Y.L.; Liu, S.J.; Liu, X.; Chen, L.M.; et al. FLOURY SHRUNKEN ENDOSPERM1 connects phospholipid metabolism and amyloplast development in rice. Plant Physiol. 2018, 177, 698–712. [Google Scholar] [CrossRef] [PubMed]
  17. Hu, T.T.; Tian, Y.L.; Zhu, J.P.; Wang, Y.L.; Jing, R.N.; Lei, J.; Sun, Y.L.; Yu, Y.F.; Li, J.F.; Chen, X.L.; et al. OsNDUFA9 encoding a mitochondrial complex I subunit is essential for embryo development and starch synthesis in rice. Plant Cell Rep. 2018, 37, 1667–1679. [Google Scholar] [CrossRef]
  18. Kim, S.R.; Yang, J.I.; Moon, S.; Ryu, C.H.; An, K.; Kim, K.M.; Yim, J.; An, G. Rice OGR1 encodes a pentatricopeptide repeat-DYW protein and is essential for RNA editing in mitochondria. Plant J. 2009, 59, 738–749. [Google Scholar] [CrossRef]
  19. Wu, M.M.; Ren, Y.L.; Cai, M.H.; Wang, Y.L.; Zhu, S.S.; Zhu, J.P.; Hao, Y.Y.; Teng, X.; Zhu, X.P.; Jing, R.N.; et al. Rice FLOURY ENDOSPERM10 encodes a pentatricopeptide repeat protein that is essential for the trans-splicing of mitochondrial nad1 intron 1 and endosperm development. New Phytol. 2019, 223, 736–750. [Google Scholar] [CrossRef]
  20. Hao, Y.Y.; Wang, Y.L.; Wu, M.M.; Zhu, X.P.; Teng, X.; Sun, Y.L.; Zhu, J.P.; Zhang, Y.Y.; Jing, R.N.; Lei, J.; et al. The nuclear-localized PPR protein OsNPPR1 is important for mitochondrial function and endosperm development in rice. J. Exp. Bot. 2019, 70, 4705–4720. [Google Scholar] [CrossRef]
  21. Yu, M.Z.; Wu, M.M.; Ren, Y.L.; Wang, Y.H.; Li, J.F.; Lei, C.L.; Sun, Y.L.; Bao, X.H.; Wu, H.M.; Yang, H.; et al. Rice FLOURY ENDOSPERM 18 encodes a pentatricopeptide repeat protein required for 5’ processing of mitochondrial nad5 mRNA and endosperm development. J. Integr. Plant Biol. 2020, 63, 834–847. [Google Scholar] [CrossRef] [PubMed]
  22. Yang, H.; Wang, Y.L.; Tian, Y.L.; Teng, X.; Lv, Z.H.; Lei, J.; Duan, E.C.; Dong, H.; Yang, X.; Zhang, Y.Y.; et al. Rice FLOURY ENDOSPERM22, encoding a pentatricopeptide repeat protein, is involved in both mitochondrial RNA splicing and editing and is crucial for endosperm development. J. Integr. Plant Biol. 2022, 65, 755–771. [Google Scholar] [CrossRef] [PubMed]
  23. Chen, C.; He, B.S.; Liu, X.X.; Ma, X.D.; Liu, Y.J.; Yao, H.Y.; Zhang, P.; Yin, J.L.; Wei, X.; Koh, H.J.; et al. Pyrophosphate-fructose 6-phosphate 1-phosphotransferase (PFP1) regulates starch biosynthesis and seed development via heterotetramer formation in rice (Oryza sativa L.). Plant Biotechnol. J. 2020, 18, 83–95. [Google Scholar] [CrossRef]
  24. Kang, H.G.; Park, S.; Matsuoka, M.; An, G. White-core endosperm floury endosperm-4 in rice is generated by knockout mutations in the C-type pyruvate orthophosphate dikinase gene (OsPPDKb). Plant J. 2005, 42, 901–911. [Google Scholar] [CrossRef]
  25. Cai, Y.C.; Li, S.F.; Jiao, G.A.; Sheng, Z.H.; Wu, Y.W.; Shao, G.N.; Xie, L.H.; Peng, C.; Xu, J.F.; Tang, S.Q.; et al. OsPK2 encodes a plastidic pyruvate kinase involved in rice endosperm starch synthesis, compound granule formation and grain filling. Plant Biotechnol. J. 2018, 16, 1878–1891. [Google Scholar] [CrossRef]
  26. Zhong, M.S.; Liu, X.; Liu, F.; Ren, Y.L.; Wang, Y.L.; Zhu, J.P.; Teng, X.; Duan, E.C.; Wang, F.; Zhang, H.; et al. FLOURY ENDOSPERM12 Encoding Alanine Aminotransferase 1 Regulates Carbon and Nitrogen Metabolism in Rice. J. Plant Biol. 2019, 62, 61–73. [Google Scholar] [CrossRef]
  27. You, X.M.; Zhang, W.W.; Hu, J.L.; Jing, R.N.; Cai, Y.; Feng, Z.M.; Kong, F.; Zhang, J.; Yan, H.G.; Chen, W.W.; et al. FLOURY ENDOSPERM15 encodes a glyoxalase I involved in compound granule formation and starch synthesis in rice endosperm. Plant Cell Rep. 2019, 38, 345–359. [Google Scholar] [CrossRef]
  28. Teng, X.; Zhong, M.S.; Zhu, X.P.; Wang, C.M.; Ren, Y.L.; Wang, Y.L.; Zhang, H.; Jiang, L.; Wang, D.; Hao, Y.Y.; et al. FLOURY ENDOSPERM16 encoding a NAD-dependent cytosolic malate dehydrogenase plays an important role in starch synthesis and seed development in rice. Plant Biotechnol. J. 2019, 17, 1914–1927. [Google Scholar] [CrossRef] [PubMed]
  29. Chen, X.L.; Ji, Y.; Zhao, W.Y.; Niu, H.Y.; Yang, X.; Jiang, X.K.L.; Zhang, Y.P.; Lei, J.; Yang, H.; Chen, R.B.; et al. Fructose-6-phosphate-2-kinase/fructose-2,6-bisphosphatase regulates energy metabolism and synthesis of storage products in developing rice endosperm. Plant Sci. 2023, 326, 111503. [Google Scholar] [CrossRef]
  30. Lei, J.; Teng, X.; Wang, Y.F.; Jiang, X.K.; Zhao, H.H.; Zheng, X.M.; Ren, Y.L.; Dong, H.; Wang, Y.L.; Duan, E.C.; et al. Plastidic pyruvate dehydrogenase complex E1 componentsubunit Alpha1 is involved in galactolipid biosynthesisrequired for amyloplast development in rice. Plant Biotechnol. J. 2022, 20, 437–453. [Google Scholar] [CrossRef]
  31. Lou, G.M.; Chen, P.L.; Zhou, H.; Li, P.B.; Xiong, J.W.; Wan, S.S.; Zheng, Y.Y.; Alam, M.; Liu, R.J.; Zhou, Y.; et al. FLOURY ENDOSPERM19 encoding a class I glutamine amidotransferase affects grain quality in rice. Mol. Breed. 2021, 41, 36. [Google Scholar] [CrossRef] [PubMed]
  32. Han, X.H.; Wang, Y.H.; Liu, X.; Jiang, L.; Ren, Y.L.; Liu, F.; Peng, C.; Li, J.J.; Jin, X.M.; Wu, F.P.; et al. The failure to express a protein disulphide isomerase-like protein results in a floury endosperm and an endoplasmic reticulum stress response in rice. J. Exp. Bot. 2012, 63, 121–130. [Google Scholar] [CrossRef] [PubMed]
  33. Ren, Y.L.; Wang, Y.H.; Liu, F.; Zhou, K.N.; Ding, Y.; Zhou, F.; Wang, Y.; Liu, K.; Gan, L.; Ma, W.W.; et al. GLUTELIN PRECURSOR ACCUMULATION3 encodes a regulator of post-Golgi vesicular traffic essential for vacuolar protein sorting in rice endosperm. Plant Cell 2014, 26, 410–425. [Google Scholar] [CrossRef] [PubMed]
  34. Liu, F.; Ren, Y.L.; Wang, Y.H.; Peng, C.; Zhou, K.N.; Lv, J.; Guo, X.P.; Zhang, X.; Zhong, M.S.; Zhao, S.L.; et al. OsVPS9A Functions Cooperatively with OsRAB5A to Regulate Post-Golgi Dense Vesicle-Mediated Storage Protein Trafficking to the Protein Storage Vacuole in Rice Endosperm Cells. Mol. Plant 2013, 6, 1918–1932. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, Y.H.; Ren, Y.L.; Liu, X.; Jiang, L.; Chen, L.M.; Han, X.H.; Jin, M.N.; Liu, S.J.; Liu, F.; Lv, J.; et al. OsRab5a regulates endomembrane organization and storage protein trafficking in rice endosperm cells. Plant J. 2010, 64, 812–824. [Google Scholar] [CrossRef]
  36. Wang, Y.H.; Liu, F.; Ren, Y.L.; Wang, Y.L.; Liu, X.; Long, W.H.; Wang, D.; Zhu, J.P.; Zhu, X.P.; Jing, R.N.; et al. GOLGI TRANSPORT 1B Regulates Protein Export from the Endoplasmic Reticulum in Rice Endosperm Cells. Plant Cell 2016, 28, 2850–2865. [Google Scholar] [CrossRef]
  37. Ren, Y.L.; Wang, Y.H.; Pan, T.; Wang, Y.L.; Wang, Y.F.; Gan, L.; Wei, Z.Y.; Wang, F.; Wu, M.M.; Jing, R.N.; et al. GPA5 Encodes a Rab5a Effector Required for Post-Golgi Trafficking of Rice Storage Proteins. Plant Cell 2020, 32, 758–777. [Google Scholar] [CrossRef]
  38. Zhu, J.P.; Ren, Y.L.; Wang, Y.L.; Liu, F.; Teng, X.; Zhang, Y.Y.; Duan, E.C.; Wu, M.M.; Zhong, M.S.; Hao, Y.Y.; et al. OsNHX5-mediated pH homeostasis is required for post-Golgi trafficking of seed storage proteins in rice endosperm cells. BMC Plant Biol. 2019, 19, 295. [Google Scholar] [CrossRef]
  39. Pan, T.; Wang, Y.H.; Jing, R.N.; Wang, Y.F.; Wei, Z.Y.; Zhang, B.L.; Lei, C.L.; Qi, Y.Z.; Wang, F.; Bao, X.H.; et al. Post-Golgi trafficking of rice storage proteins requires the small GTPase Rab7 activation complex MON1–CCZ1. Plant Physiol. 2021, 187, 2174–2191. [Google Scholar] [CrossRef]
  40. Zhu, J.P.; Ren, Y.L.; Zhang, Y.Y.; Yang, J.; Duan, E.C.; Wang, Y.L.; Liu, F.; Wu, M.M.; Pan, T.; Wang, Y.F.; et al. Subunit E isoform 1 of vacuolar H+-ATPase OsVHA enables post-Golgi trafficking of rice seed storage proteins. Plant Physiol. 2021, 187, 2192–2208. [Google Scholar] [CrossRef]
  41. Wang, R.Q.; Ren, Y.L.; Yan, H.G.; Teng, X.; Zhu, X.P.; Wang, Y.P.; Zhang, X.; Guo, X.P.; Lin, Q.B.; Cheng, Z.J.; et al. ENLARGED STARCH GRAIN1 affects amyloplast development and starch biosynthesis in rice endosperm. Plant Sci. 2021, 305, 110831. [Google Scholar] [CrossRef] [PubMed]
  42. Liu, J.X.; Wu, X.B.; Yao, X.F.; Yu, R.; Larkin, P.; Liu, C.M. DNA demethylation by ROS1a in rice vegetative cells promotes methylation in sperm. Proc. Natl. Acad. Sci. USA 2018, 115, 11327–11332. [Google Scholar] [CrossRef] [PubMed]
  43. Yan, M.; Pan, T.; Zhu, Y.; Jiang, X.; Yu, M.; Wang, R.; Zhang, F.; Luo, S.; Bao, X.; Chen, Y.; et al. FLOURY ENDOSPERM20 encoding SHMT4 is required for rice endosperm development. Plant Biotechnol. J. 2022, 20, 1438–1440. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, J.C.; Xu, H.; Zhu, Y.; Liu, Q.Q.; Cai, X.L. OsbZIP58, a basic leucine zipper transcription factor, regulates starch biosynthesis in rice endosperm. J. Exp. Bot. 2013, 64, 3453–3466. [Google Scholar] [CrossRef]
  45. Fu, F.F.; Xue, H.W. Coexpression analysis identifies Rice Starch Regulator1, a rice AP2/EREBP family transcription factor, as a novel rice starch biosynthesis regulator. Plant Physiol. 2010, 154, 927–938. [Google Scholar] [CrossRef]
  46. Bello, B.K.; Hou, Y.X.; Zhao, J.; Jiao, G.A.; Wu, Y.W.; Li, Z.Y.; Wang, Y.F.; Tong, X.H.; Wang, W.; Yuan, W.Y.; et al. NF-YB1-YC12-bHLH144 complex directly activates Wx to regulate grain quality in rice (Oryza sativa L.). Plant Biotechnol. J. 2019, 17, 1222–1235. [Google Scholar] [CrossRef]
  47. Xiong, Y.F.; Ren, Y.; Li, W.; Wu, F.S.; Yang, W.J.; Huang, X.L.; Yao, J.L. NF-YC12 is a key multi-functional regulator of accumulation of seed storage substances in rice. J. Exp. Bot. 2019, 70, 3765–3780. [Google Scholar] [CrossRef]
  48. She, K.C.; Kusano, H.; Koizumi, K.; Yamakawa, H.; Hakata, M.; Imamura, T.; Fukuda, M.; Naito, N.; Tsurumaki, Y.; Yaeshima, M.; et al. A novel factor FLOURY ENDOSPERM2 is involved in regulation of rice grain size and starch quality. Plant Cell 2010, 22, 3280–3294. [Google Scholar] [CrossRef]
  49. Zhang, L.; Li, N.; Zhang, J.; Zhao, L.; Wei, C. The CBM48 domain-containing protein FLO6 regulates starch synthesis by interacting with SSIVb and GBSS in rice. Plant Mol. Biol. 2022, 108, 343–361. [Google Scholar] [CrossRef]
  50. Zhang, L.; Ren, Y.L.; Lu, B.Y.; Wan, J.M. FLOURY ENDOSPERM7 encodes a regulator of starch synthesis and amyloplast development essential for peripheral endosperm development in rice. J. Exp. Bot. 2016, 67, 633–647. [Google Scholar] [CrossRef]
  51. Zhu, X.P.; Teng, X.; Wang, Y.L.; Hao, Y.Y.; Jing, R.N.; Wang, Y.F.; Liu, Y.; Zhu, J.P.; Wu, M.M.; Zhong, M.S.; et al. FLOURY ENDOSPERM11 encoding a plastid heat shock protein 70 is essential for amyloplast development in rice. Plant Sci. 2018, 277, 89–99. [Google Scholar] [CrossRef] [PubMed]
  52. Yan, H.G.; Zhang, W.W.; Wang, Y.H.; Jin, J.; Xu, H.C.; Fu, Y.S.; Shan, Z.Z.; Wang, X.; Teng, X.; Li, X.; et al. LIKE EARLY STARVATION1 cooperates with FLOURY ENDOSPERM6 to modulate starch biosynthesis and endosperm development. Plant Cell 2024, 36, 1892–1912. [Google Scholar] [CrossRef] [PubMed]
  53. Huang, L.C.; Tan, H.Y.; Zhang, C.Q.; Li, Q.F.; Liu, Q.Q. Starch biosynthesis in cereal endosperms: An updated review over the last decade. Plant Commun. 2021, 2, 100237. [Google Scholar] [CrossRef]
  54. Borisjuk, L.; Rolletschek, H. The oxygen status of the developing seed. New Phytol. 2009, 182, 17–30. [Google Scholar] [CrossRef] [PubMed]
  55. Rolletschek, H.; Koch, K.; Wobus, U.; Borisjuk, L. Positional cues for the starch/lipid balance in maize kernels and resource partitioning to the embryo. Plant J. 2005, 42, 69–83. [Google Scholar] [CrossRef]
  56. Hu, L.; Tu, B.; Yang, W.; Yuan, H.; Li, J.L.; Guo, L.N.; Zheng, L.; Chen, W.L.; Zhu, X.B.; Wang, Y.P.; et al. Mitochondria-Associated Pyruvate Kinase Complexes Regulate Grain Filling in Rice. Plant Physiol. 2020, 183, 1073–1087. [Google Scholar] [CrossRef]
  57. Lee, S.K.; Jeon, J.S. Review: Crucial Role of Inorganic Pyrophosphate in Integrating Carbon Metabolism from Sucrose Breakdown to Starch Synthesis in Rice Endosperm. Plant Sci. 2020, 298, 110572. [Google Scholar] [CrossRef]
  58. Imaizumi, N.; Ku, M.S.; Ishihara, K.; Samejima, M.; Kaneko, S.; Matsuoka, M. Characterization of the gene for pyruvate, orthophosphate dikinase from rice, a C3 plant, and a comparison of structure and expression between C3 and C4 genes for this protein. Plant Mol. Biol. 1997, 34, 701–716. [Google Scholar] [CrossRef] [PubMed]
  59. Plaxton, W.C.; Podestá, F.E. The functional organization and control of plant respiration. Crit. Rev. Plant Sci. 2006, 25, 159–198. [Google Scholar] [CrossRef]
  60. Lappe, R.R.; Baier, J.W.; Boehlein, S.K.; Huffman, R.; Lin, Q.H.; Wattebled, F.; Settles, A.M.; Hannah, L.C.; Borisjuk, L.; Rolletschek, H.; et al. Functions of maize genes encoding pyruvate phosphate dikinase in developing endosperm. Proc. Natl. Acad. Sci. USA 2018, 115, 24–33. [Google Scholar] [CrossRef]
  61. Chastain, C.J.; Heck, J.W.; Colquhoun, T.A.; Voge, D.G.; Gu, X.-Y. Posttranslational regulation of pyruvate, orthophosphate dikinase in developing rice (Oryza sativa) seeds. Planta 2006, 224, 924–934. [Google Scholar] [CrossRef] [PubMed]
  62. Zhou, H.J.; Wang, L.J.; Liu, G.F.; Meng, X.B.; Jing, Y.H.; Shu, X.L.; Kong, X.L.; Sun, J.; Yu, H.; Smith, S.M.; et al. Critical roles of soluble starch synthase SSIIIa and granule-bound starch synthase Waxy in synthesizing resistant starch in rice. Proc. Natl. Acad. Sci. USA 2016, 113, 12844–12849. [Google Scholar] [CrossRef] [PubMed]
  63. Matsuba, S.; Maruyama-Funatsuki, W.; Umemoto, T.; Kato, H.; Kuroki, M.; Yokogami, N.; Ikegaya, T.; Shimizu, H.; Iriki, N. The Induced Mutant Allele flo4-303 Confers Floury Characteristics on the Japonica Rice Cultivar ‘Hoshinoko’. Breed. Sci. 2022, 72, 383–388. [Google Scholar] [CrossRef] [PubMed]
  64. Wang, H.; Mo, Y.; Im, D.E.; Jang, S.G.; Ham, T.H.; Lee, J.; Jeung, J.U.; Kwon, S.W. A New SNP in CyOsPPDK Gene is Associated with Floury Endosperm in Suweon 542. Mol. Genet. Genom. 2018, 293, 1151–1158. [Google Scholar] [CrossRef] [PubMed]
  65. Wang, H.; Ham, T.H.; Im, D.E.; Lar, S.M.; Jang, S.G.; Lee, J.; Mo, Y.; Jeung, J.U.; Kim, S.T.; Kwon, S.W. A New SNP in Rice Gene Encoding Pyruvate Phosphate Dikinase (PPDK) Associated with Floury Endosperm. Genes 2020, 11, 465. [Google Scholar] [CrossRef]
  66. Ha, S.K.; Lee, H.S.; Lee, S.Y.; Lee, C.M.; Mo, Y.J.; Jeung, J.U. Characterization of flo4-6, a novel cyOsPPDKB allele conferring floury endosperm characteristics suitable for dry-milled rice flour production. Agronomy 2023, 13, 1306. [Google Scholar] [CrossRef]
  67. Zhang, L.; Zhao, L.L.; Lin, L.S.; Zhao, L.X.; Liu, Q.Q.; Wei, C.X. A Novel Mutation of OsPPDKB, Encoding Pyruvate Orthophosphate Dikinase, Affects Metabolism and Structure of Starch in the Rice Endosperm. Int. J. Mol. Sci. 2018, 19, 2268. [Google Scholar] [CrossRef]
  68. Muroyama, R.; Ito, H.; Takahashi, S.; Kang, D.J.; Hamada, S. Biochemical Analysis of a Novel Allele of the OsPPDKB Gene Associated with Floury Endosperm. J. Cereal Sci. 2022, 107, 103529. [Google Scholar] [CrossRef]
  69. Ando, T.; Yamamoto, T.; Shimizu, T.; Ma, X.F.; Shomura, A.; Takeuchi, Y.; Lin, S.Y.; Yano, M. Genetic dissection and pyramiding of quantitative traits for panicle architecture by using chromosomal segment substitution lines in rice. Theor. Appl. Genet. 2008, 116, 881–890. [Google Scholar] [CrossRef]
  70. Liu, J.X.; Wu, M.W.; Liu, C.M. Cereal Endosperms: Development and Storage Product Accumulation. Annu. Rev. Plant Biol. 2022, 73, 255–291. [Google Scholar] [CrossRef]
  71. Mo, Y.; Jeung, J.-U. The Use of Floury Endosperm Mutants to Develop Rice Cultivars Suitable for Dry Milling. Plant Biotechnol. Rep. 2020, 14, 185–191. [Google Scholar] [CrossRef]
  72. Mo, Y.; Jeung, J.-U.; Shin, Y.-S.; Park, C.S.; Kang, K.-H.; Kim, B.-K. Agronomic and Genetic Analysis of Suweon 542, a Rice Floury Mutant Line Suitable for Dry Milling. Rice 2013, 6, 37. [Google Scholar] [CrossRef] [PubMed]
  73. Won, Y.-J.; Ahn, E.-K.; Jeong, E.-G.; Chang, J.-K.; Lee, J.-H.; Jung, K.-H.; Hyun, U.-J.; Cho, Y.-C.; Oh, S.-K.; Yoon, M.-R.; et al. An Opaque Endosperm Rice Cultivar, ‘Hangaru’, Suitable for Exclusive Dry-Milling Rice Flour Production. Korean J. Breed. Sci. 2019, 51, 134–139. [Google Scholar] [CrossRef]
  74. Cho, Y.; Baek, M.; Park, H.; Cho, J.; Ahn, E.; Suh, J.; Jeung, J. ‘Shingil (Milyang317)’, Tongil-Type Variety Specialized for Rice Flour. Korean J. Breed. Sci. 2020, 72, 58–72. [Google Scholar] [CrossRef]
  75. Takahashi, K.; Kohno, H.; Okuda, M. Spatial Distribution and Characteristics of Protein Content and Composition in Japonica Rice Grains: Implications for Sake Quality. Rice 2024, 17, 26. [Google Scholar] [CrossRef]
  76. Yang, Y.H.; Zhang, Y.; Sun, Z.X.; Shen, Z.Y.; Li, Y.G.; Guo, Y.F.; Feng, Y.T.; Sun, S.Y.; Guo, M.; Hu, Z.; et al. Knocking out OsAAP11 to improve rice grain quality using CRISPR/Cas9 system. Int. J. Mol. Sci. 2023, 24, 14360. [Google Scholar] [CrossRef]
  77. Bradford, M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
  78. Saito, Y.; Shigemitsu, T.; Yamasaki, R.; Sasou, A.; Goto, F.; Kishida, K.; Kuroda, M.; Tanaka, K.; Morita, S.; Satoh, S.; et al. Formation mechanism of the internal structure of type I protein bodies in rice endosperm: Relationship between the localization of prolamin species and the expression of individual genes. Plant J. 2012, 70, 1043–1055. [Google Scholar] [CrossRef] [PubMed]
  79. Sun, J.; Wang, Y.; Zhang, X.Q.; Rasmussen, S.K.; Jiang, X.T.; Song, W.J.; Wu, D.X.; Shu, X.L. Dependence of physiochemical, functional and textural properties of high–resistant starch rice on endogenous nonstarch polysaccharides. Inte. J. Food Sci. Technol. 2018, 53, 1079–1086. [Google Scholar] [CrossRef]
  80. Abe, A.; Kosugi, S.; Yoshida, K.; Natsume, S.; Takagi, H.; Kanzaki, H.; Matsumura, H.; Yoshida, K.; Mitsuoka, C.; Tamiru, M.; et al. Genome sequencing reveals agronomically important loci in rice using MutMap. Nat. Biotechnol. 2012, 30, 174–178. [Google Scholar] [CrossRef]
Plants 13 02653 g001
Figure 1. Phenotypic and crop traits analysis of the wcr mutant and wild type. (A) The whole plants of the Sa-Sasanishiki wild-type and wcr, scale bar = 10 cm. (B) The brown rice of the Sa and wcr, scale bar = 10 mm. (C) The cross-section of the Sa and wcr grains, scale bar = 1 mm. (D) Electron microscopic scanning of the endosperm of Sa and wcr, black scale bar = 10 μm, white scale bar = 200 μm. Different colored boxes represent local enlargements of starch structures. (E–J) The crop traits of Sa and wcr. Different upper case letters denote significant statistical differences between Sa (orange) and wcr (blue) plants, with the p-value < 0.01.
Figure 1. Phenotypic and crop traits analysis of the wcr mutant and wild type. (A) The whole plants of the Sa-Sasanishiki wild-type and wcr, scale bar = 10 cm. (B) The brown rice of the Sa and wcr, scale bar = 10 mm. (C) The cross-section of the Sa and wcr grains, scale bar = 1 mm. (D) Electron microscopic scanning of the endosperm of Sa and wcr, black scale bar = 10 μm, white scale bar = 200 μm. Different colored boxes represent local enlargements of starch structures. (E–J) The crop traits of Sa and wcr. Different upper case letters denote significant statistical differences between Sa (orange) and wcr (blue) plants, with the p-value < 0.01.
Plants 13 02653 g001
Plants 13 02653 g002
Figure 2. Physicochemical properties of mature grains of Sa and wcr mutant. (A–F) The contents of total starch, amylose, albumin, globulin, prolamin, and glutelin in brown rice flour and milled rice flour of Sa and wcr mutant. Different small case letters denote statistical differences between Sa (orange) and wcr (blue) plants in the same rice type (brown or milled); different upper case letters denote statistical differences between brown or milled rice types in the same wild type or wcr plants. (G) The SDS-PAGE analysis of storage proteins of Sa and wcr mutant rice flour. (H) Changes in the contents of storage substances in the inner and outer endosperm of wcr compared to wild type (the yellow part indicates the outer endosperm; the white part indicates the inner endosperm; Red arrows represent up-regulated levels, light green and dark green arrows represent down-regulated levels, and purple horizontal lines indicate unchanged levels; TSC, total starch content; AC, amylose content; Alb, albumin; Glo, globulin; Prol, prolamin; Glut, glutelin).
Figure 2. Physicochemical properties of mature grains of Sa and wcr mutant. (A–F) The contents of total starch, amylose, albumin, globulin, prolamin, and glutelin in brown rice flour and milled rice flour of Sa and wcr mutant. Different small case letters denote statistical differences between Sa (orange) and wcr (blue) plants in the same rice type (brown or milled); different upper case letters denote statistical differences between brown or milled rice types in the same wild type or wcr plants. (G) The SDS-PAGE analysis of storage proteins of Sa and wcr mutant rice flour. (H) Changes in the contents of storage substances in the inner and outer endosperm of wcr compared to wild type (the yellow part indicates the outer endosperm; the white part indicates the inner endosperm; Red arrows represent up-regulated levels, light green and dark green arrows represent down-regulated levels, and purple horizontal lines indicate unchanged levels; TSC, total starch content; AC, amylose content; Alb, albumin; Glo, globulin; Prol, prolamin; Glut, glutelin).
Plants 13 02653 g002
Plants 13 02653 g003
Figure 3. Gelatinization characteristics and amylopectin structure analysis of wcr mutant. (A,B) Comparison of the swelling volume of brown rice flour between Sa and wcr mutant under different urea concentrations. The p-values < 0.05 * and <0.01 ** calculated using an independent-samples t-test. (C) Determination of amylopectin chain length distribution in Sa and wcr mutant brown rice flour.
Figure 3. Gelatinization characteristics and amylopectin structure analysis of wcr mutant. (A,B) Comparison of the swelling volume of brown rice flour between Sa and wcr mutant under different urea concentrations. The p-values < 0.05 * and <0.01 ** calculated using an independent-samples t-test. (C) Determination of amylopectin chain length distribution in Sa and wcr mutant brown rice flour.
Plants 13 02653 g003
Plants 13 02653 g004
Figure 4. Fine mapping of the wcr gene. (A) The MutMap analysis of the wcr gene. (B) Fine mapping of the wcr gene using linkage analysis. (C) The gene structure of the LOC_Os05g33570. (D) The Sanger chromatogram of the WT and wcr.
Figure 4. Fine mapping of the wcr gene. (A) The MutMap analysis of the wcr gene. (B) Fine mapping of the wcr gene using linkage analysis. (C) The gene structure of the LOC_Os05g33570. (D) The Sanger chromatogram of the WT and wcr.
Plants 13 02653 g004
Plants 13 02653 g005
Figure 5. Gene expression analysis of storage substance-related genes of Sa and the wcr mutant. (A) Gene expression analysis of grain protein biosynthesis genes. (B) Gene expression analysis of grain starch metabolism genes.
Figure 5. Gene expression analysis of storage substance-related genes of Sa and the wcr mutant. (A) Gene expression analysis of grain protein biosynthesis genes. (B) Gene expression analysis of grain starch metabolism genes.
Plants 13 02653 g005
Plants 13 02653 g006
Figure 6. The structure of cyOsPPDKB. The wcr mutant is highlighted in red boxes. Previously reported allelic mutants of cyOsPPDKB are indicated in blue boxes.
Figure 6. The structure of cyOsPPDKB. The wcr mutant is highlighted in red boxes. Previously reported allelic mutants of cyOsPPDKB are indicated in blue boxes.
Plants 13 02653 g006
Table 1. Reported floury endosperm genes.
Table 1. Reported floury endosperm genes.
ClassificationNameGene IDAnnotation
Starch synthesis and sucrose metabolismFLO8Os09g0553200UTP-glucose-1-phosphate uridylyltransferase [4]
OsAGPL2Os01g0633100Glucose-1-phosphate adenylyltransferase large subunit [5]
OsAGPSOs09g0298200Glucose-1-phosphate adenylyltransferase large subunit [5]
OsBT1Os02g0202400ADP-Glucose Transporter [6]
OsBEIIbOs02g05282001,4-alpha-glucan-branching enzyme [7]
FLO5Os08g0191433Starch synthase III [8]
Pho1Os03g0758100Alpha-glucan phosphorylase isozyme [9]
GIF1Os04g0413500Cell wall invertase [10]
WxOs06g0133000Starch synthase [11]
FLO24Os03g0426900Heat shock protein 101 [12]
Amyloplast developmentSSG4Os01g0179400Protein containing a DUF490 domain [13]
SSG6Os06g0130400Aminotransferase [14]
SSG7Os11g0524300Plant-specific DUF1001 domain-containing protein [15]
FSE1Os08g0110700Phospholipase-like protein [16]
Energy supplyFLO13Os02g0816800Mitochondrial complex I subunit [17]
OGR1Os12g0270200Pentatricopeptide repeat–DYW protein [18]
FLO10Os03g0168400Pentatricopeptide repeat protein [19]
OsNPPR1Os08g0290000Pentatricopeptide repeat protein [20]
FLO18Os07g0688100Pentatricopeptide repeat protein [21]
FLO22Os07g0179000P-type pentatricopeptide repeat (PPR) protein [22]
Glycolytic metabolismPFPβOs06g0247500Pyrophosphate-fructose 6-phosphate 1-phosphotransferase [23]
FLO4Os05g0405000Pyruvate, phosphate dikinase [24]
OsPK2Os07g0181000Plastidic pyruvate kinase [25]
FLO12Os10g0390500Aminotransferase [26]
FLO15Os05g0230900Glyoxalase family protein [27]
FLO16Os10g0478200Lactate/malate dehydrogenase [28]
FLO23Os03g0294200Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase [29]
FLO19Os04g0119400Pyruvate dehydrogenase complex E1 component subunit α1 [30]
FLO19Os03g0685300Class I glutamine amidotransferase [31]
Protein processing and transportPDIL1-1Os11g0199200Protein disulfide isomerase-like enzyme [32]
GPA1Os12g0631100Small GTPase [33]
GPA2Os03g0262900Guanine nucleotide exchange factor [34]
GPA3Os03g0835800Regulator of post-Golgi vesicular traffic [35]
GPA4Os03g0209400Golgi Transport 1 [36]
GPA5Os06g0643000Rab5a Effector [37]
GPA6Os09g0286400Vacuolar Na+/H+ antiporter [38]
GPA7Os08g0427300Homolog of Arabidopsis CCZ1a and CCZ1b [39]
GPA8Os01g0659200Subunit E isoform 1 of vacuolar H+-ATPase [40]
Lipid transportESG1Os04g0553000Bacterial MlaE lipid transfer protein [41]
EpigeneticsOsROS1Os01g0218032DNA demethylase [42]
FLO20-1Os01g0874900Serine hydroxymethyltransferase [43]
Transcriptional regulation and protein interactionRISBZ1Os07g0182000bZIP transcription factor [44]
RSR1Os05g0121600Transcription factor of the AP2/EREBP family [45]
NF-YB1Os02g0725900Nuclear transcription factor Y subunit B [46]
NF-YC12Os05g0304800CCAAT-box-binding transcription factor [46,47]
bHLH144Os04g0429400Helix-loop-helix DNA-binding domain containing protein [46]
FLO2Os04g0645100Tetratricopeptide repeat domain-containing protein [48]
FLO6Os03g0686900CBM48 domain-containing protein [49]
FLO7Os10g0463800DUF1388 domain protein [50]
FLO11Os12g0244100Plastid heat shock protein 70 [51]
FLO9Os11g0586300Homologous to Arabidopsis LIKE EARLY STARVATION1 [52]
Table 2. The primers used for fine-mapping the wcr.
Table 2. The primers used for fine-mapping the wcr.
NameForward Primer (5′-3′)Reverse Primer (5′-3′)
C5.5CTATGCAGTGCAGTGTGCACAGCCGAAGGAGGTGTGAATC
C5.4GCTCAAGCAAGGTCCATTCCCAGCTACTAGGCCCCATTTG
C5.3CCTGGCGTCAAACACATCTGCTGAGGGTGTTCTTTTGGGC
C5.2ATGGGAGAAGTGTCCAGCAGGTGTGGACTGTGGATTGTGG
C5.1AGAACGGAGGGAGTAGGATCTCGCGGCTCTGAATTACCAG
C5.8GTCCACCCGTTTCTTGCATGCCACCCGTTTCTTGCATACC
C5.9CCGGATTGTAGCTGTAGCTCGGGTCACAGCATCAAAGCAG
C5.12GTGCTGGAAACTCCATGTCGATGGCTCTATCGGTGTCAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, Y.; Yang, X.; Wu, L.; Sun, Z.; Zhang, Y.; Shen, Z.; Zhou, J.; Guo, M.; Yan, C. Phenotypic Analysis and Gene Cloning of Rice Floury Endosperm Mutant wcr (White-Core Rice). Plants 2024, 13, 2653. https://doi.org/10.3390/plants13182653

AMA Style

Yang Y, Yang X, Wu L, Sun Z, Zhang Y, Shen Z, Zhou J, Guo M, Yan C. Phenotypic Analysis and Gene Cloning of Rice Floury Endosperm Mutant wcr (White-Core Rice). Plants. 2024; 13(18):2653. https://doi.org/10.3390/plants13182653

Chicago/Turabian Style

Yang, Yihao, Xiaoyi Yang, Lingjun Wu, Zixing Sun, Yi Zhang, Ziyan Shen, Juan Zhou, Min Guo, and Changjie Yan. 2024. "Phenotypic Analysis and Gene Cloning of Rice Floury Endosperm Mutant wcr (White-Core Rice)" Plants 13, no. 18: 2653. https://doi.org/10.3390/plants13182653

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop