Carbon Monoxide Alleviates Salt-Induced Oxidative Damage in Sorghum bicolor by Inducing the Expression of Proline Biosynthesis and Antioxidant Genes
Abstract
:1. Introduction
2. Results
2.1. Carbon Monoxide Improves Seed Germination and Root Growth of Sorghum under Salt Stress
2.2. CO Reduces Salt-Induced Oxidative Damage in Sorghum Seedlings
2.3. CO Increases Proline and Total Soluble Sugar Content in Sorghum under Salt Stress
2.4. Morphology and Element Analysis
2.4.1. Co Improves the Morphology of Sorghum Anatomy
2.4.2. CO Reduces Na+ Toxicity and Improves K+ Content
2.4.3. CO Stabilizes the Nature and Structure of Biomolecules
2.5. Effect of CO on the Activity and Expression of Heme Oxygenase in Sorghum under Salt Stress
2.6. Influence of CO on the Transcript Level of Antioxidant Genes in Sorghum Seedlings under Salt Stress
2.7. Pearson’s Traits Correlations
3. Discussion
4. Materials and Methods
4.1. Seed Preparation and Growth Conditions
4.2. Chemicals and Treatments
4.3. Growth Analysis
4.3.1. Germination Index
4.3.2. Root Length
4.4. Histochemical Staining
4.5. Hydrogen Peroxide Content
4.6. Proline Content
4.7. Scanning Electron Microscopy Analysis
4.8. FTIR Spectroscopic Analysis
4.9. Heme Oxygenase Activity Assay
4.10. Protein Extraction and Quantification
4.11. Western Blot Analysis for Heme Oxygenase
4.12. Total RNA Extraction and Reverse Transcription
4.13. Semi-Quantitative RT-PCR
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Balakrishna, D.; Vinodh, R.; Madhu, P.; Avinash, S.; Rajappa, P.V.; Bhat, B.V. Tissue Culture and Genetic Transformation in Sorghum Bicolor; Breeding Sorghum for Diverse End Uses, Woodhead Publishing.: Sawston, UK, 2019. [Google Scholar]
- FAO. The State of Food and Agriculture 2015 (SOFA): Social Protection and Agriculture: Breaking the Cycle of Rural Poverty; FAO: Rome, Italy, 2015. [Google Scholar]
- Mundia, C.W.; Secchi, S.; Akamani, K.; Wang, G. A Regional Comparison of Factors Affecting Global Sorghum Production: The Case of North America, Asia and Africa’s Sahel. Sustainability 2019, 11, 2135. [Google Scholar] [CrossRef]
- Tari, I.; Laskay, G.; Takács, Z.; Poór, P. Response of Sorghum to Abiotic Stresses: A Review. J. Agron. Crop. Sci. 2013, 199, 264–274. [Google Scholar] [CrossRef]
- Reddy, P.S.; Reddy, D.S.; Sivasakthi, K.; Bhatnagar-Mathur, P.; Vadez, V.; Sharma, K.K. Evaluation of Sorghum [Sorghum bicolor (L.)] Reference Genes in Various Tissues and under Abiotic Stress Conditions for Quantitative Real-Time PCR Data Normalization. Front. Plant Sci. 2016, 7, 529. [Google Scholar] [CrossRef]
- Mulaudzi, T.; Hendricks, K.; Mabiya, T.; Muthevhuli, M.; Ajayi, R.F.; Mayedwa, N.; Gehring, C.; Iwuoha, E. Calcium Improves Germination and Growth of Sorghum bicolor Seedlings under Salt Stress. Plants 2020, 9, 730. [Google Scholar] [CrossRef]
- Huang, R.-D. Research progress on plant tolerance to soil salinity and alkalinity in sorghum. J. Integr. Agric. 2018, 17, 739–746. [Google Scholar] [CrossRef]
- Nxele, X.; Klein, A.; Ndimba, B. Drought and salinity stress alters ROS accumulation, water retention, and osmolyte content in sorghum plants. S. Afr. J. Bot. 2017, 108, 261–266. [Google Scholar] [CrossRef]
- Krishnamurthy, L.; Serraj, R.; Hash, C.T.; Dakheel, A.J.; Reddy, B.V.S. Screening sorghum genotypes for salinity tolerant biomass production. Euphytica 2007, 156, 15–24. [Google Scholar] [CrossRef]
- Mbinda, W.; Kimtai, M. Evaluation of Morphological and Biochemical Characteristics of Sorghum [Sorghum bicolor [L.] Moench] Varieties in Response Salinity Stress. Annu. Res. Rev. Biol. 2019, 33, 1–9. [Google Scholar] [CrossRef]
- Mulaudzi, T.; Sias, G.; Nkuna, M.; Ndou, N.; Hendricks, K.; Ikebudu, V.; Koo, A.J.; Ajayi, R.F.; Iwuoha, E. Seed Priming with MeJa Prevents Salt-Induced Growth Inhibition and Oxidative Damage in Sorghum bicolor by Inducing the Expression of Jasmonic Acid Biosynthesis Genes. Int. J. Mol. Sci. 2023, 24, 10368. [Google Scholar] [CrossRef]
- Mulaudzi, T.; Nkuna, M.; Sias, G.; Doumbia, I.Z.; Njomo, N.; Iwuoha, E. Antioxidant Capacity of Chitosan on Sorghum Plants under Salinity Stress. Agriculture 2022, 12, 1544. [Google Scholar] [CrossRef]
- Mabiya, T.C.; Hendricks, K.; Nkuna, M.; Faro, A.; Doumbia, I.Z.; Ajayi, R.F.; Iwuoha, E.; Ndimba, B.K.; Mulaudzi, T. Molybdenum improves Sorghum bicolor tolerance to salt stress by regulating the antioxidant system and the heat shock protein 70 expression. Int. J. Phytol. Res. 2023, 3, 30–40. [Google Scholar]
- Rakgotho, T.; Ndou, N.; Mulaudzi, T.; Iwuoha, E.; Mayedwa, N.; Ajayi, R.F. Green-Synthesized Zinc Oxide Nanoparticles Mitigate Salt Stress in Sorghum bicolor. Agriculture 2022, 12, 597. [Google Scholar] [CrossRef]
- Goche, T.; Shargie, N.G.; Cummins, I.; Brown, A.P.; Chivasa, S.; Ngara, R. Comparative physiological and root proteome analyses of two sorghum varieties responding to water limitation. Sci. Rep. 2020, 10, 11835. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef]
- Kumar, S.; Li, G.; Yang, J.; Huang, X.; Ji, Q.; Liu, Z.; Ke, W.; Hou, H. Effect of Salt Stress on Growth, Physiological Parameters, and Ionic Concentration of Water Dropwort (Oenanthe javanica) Cultivars. Front. Plant Sci. 2021, 12, 660409. [Google Scholar] [CrossRef]
- Arif, Y.; Singh, P.; Siddiqui, H.; Bajguz, A.; Hayat, S. Salinity induced physiological and biochemical changes in plants: An omic approach towards salt stress tolerance. Plant Physiol. Biochem. 2020, 156, 64–77. [Google Scholar] [CrossRef] [PubMed]
- Shrivastava, P.; Kumar, R. Soil salinity: A serious environmental issue and plant growth promoting bacteria as one of the tools for its alleviation. Saudi J. Biol. Sci. 2014, 22, 123–131. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Du, M.; Tian, H.; Wang, B. Exposure to High Salinity During Seed Development Markedly Enhances Seedling Emergence and Fitness of the Progeny of the Extreme Halophyte Suaeda salsa. Front. Plant Sci. 2020, 11, 1291. [Google Scholar] [CrossRef] [PubMed]
- Bybordi, A. The influence of salt stress on seed germination, growth and yield of canola cultivars. Not. Bot. Horti Agrobot. 2010, 38, 128–133. [Google Scholar]
- Çamlıca, M.; Yaldız, G. Effect of Salt Stress on Seed Germination, Shoot and Root Length in Basil (Ocimum basilicum). Int. J. Second. Metab. 2017, 4, 69–76. [Google Scholar] [CrossRef]
- Shahid, M.A.; Sarkhosh, A.; Khan, N.; Balal, R.M.; Ali, S.; Rossi, L.; Gómez, C.; Mattson, N.; Nasim, W.; Garcia-Sanchez, F. Insights into the Physiological and Biochemical Impacts of Salt Stress on Plant Growth and Development. Agronomy 2020, 10, 938. [Google Scholar] [CrossRef]
- Zhang, F.; Sapkota, S.; Neupane, A.; Yu, J.; Wang, Y.; Zhu, K.; Lu, F.; Huang, R.; Zou, J. Effect of salt stress on growth and physiological parameters of sorghum genotypes at an early growth stage. Indian J. Exp. Biol. 2020, 58, 404–411. [Google Scholar]
- Hasanuzzaman, M.; Nahar, K.; Alam, M.M.; Roychowdhury, R.; Fujita, M. Physiological, Biochemical, and Molecular Mechanisms of Heat Stress Tolerance in Plants. Int. J. Mol. Sci. 2013, 14, 9643–9684. [Google Scholar] [CrossRef] [PubMed]
- Hasanuzzaman, M.; Fujita, M.; Oku, H.; Nahar, K.; Hawrylak-Nowak, B. Plant Nutrients and Abiotic Stress Tolerance; Springer: Berlin/Heidelberg, Germany, 2018; pp. 1–590. [Google Scholar] [CrossRef]
- Hao, S.; Wang, Y.; Yan, Y.; Liu, Y.; Wang, J.; Chen, S. A Review on Plant Responses to Salt Stress and Their Mechanisms of Salt Resistance. Horticulturae 2021, 7, 132. [Google Scholar] [CrossRef]
- Dehnavi, A.R.; Zahedi, M.; Ludwiczak, A.; Perez, S.C.; Piernik, A. Effect of Salinity on Seed Germination and Seedling Development of Sorghum (Sorghum bicolor (L.) Moench) Genotypes. Agronomy 2020, 10, 859. [Google Scholar] [CrossRef]
- Rahman, A.; Nahar, K.; Hasanuzzaman, M.; Fujita, M. Calcium Supplementation Improves Na+/K+ Ratio, Antioxidant Defense and Glyoxalase Systems in Salt-Stressed Rice Seedlings. Front. Plant Sci. 2016, 7, 609. [Google Scholar] [CrossRef] [PubMed]
- Li, W. Effect of Environmental Salt Stress on Plants and the Molecular Mechanism of Salt Stress Tolerance. Int. J. Environ. Sci. Nat. Resour. 2017, 7, 555714. [Google Scholar] [CrossRef]
- Gill, S.S.; Anjum, N.A.; Gill, R.; Tuteja, N. Abiotic Stress Response in Plants—An Overview: Tuteja/Abiotic Stress Response in Plants. In Abiotic Stress Response in Plants; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2016; pp. 1–12. [Google Scholar]
- Das, K.; Roychoudhury, A. Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front. Environ. Sci. 2014, 2, 53. [Google Scholar] [CrossRef]
- Heidari, M. Antioxidant Activity and Osmolyte Concentration of Sorghum (Sorghum bicolor) and Wheat (Triticum aestivum) Genotypes under Salinity Stress. Asian J. Plant Sci. 2009, 8, 240–244. [Google Scholar] [CrossRef]
- Chauhan, J.; Srivastava, J.P.; Singhal, R.K.; Soufan, W.; Dadarwal, B.K.; Mishra, U.N.; Anuragi, H.; Rahman, A.; Sakran, M.I.; Brestic, M.; et al. Alterations of Oxidative Stress Indicators, Antioxidant Enzymes, Soluble Sugars, and Amino Acids in Mustard [Brassica juncea (L.) Czern and Coss.] in Response to Varying Sowing Time, and Field Temperature. Front. Plant Sci. 2022, 13, 875009. [Google Scholar] [CrossRef]
- Ghosh, U.K.; Islam, M.N.; Siddiqui, M.N.; Khan, M.A.R. Understanding the roles of osmolytes for acclimatizing plants to changing environment: A review of potential mechanism. Plant Signal. Behav. 2021, 16, 1913306. [Google Scholar] [CrossRef] [PubMed]
- Shekhawat, G.S.; Verma, K. Haem oxygenase (HO): An overlooked enzyme of plant metabolism and defence. J. Exp. Bot. 2010, 61, 2255–2270. [Google Scholar] [CrossRef] [PubMed]
- Mulaudzi-Masuku, T.; Ikebudu, V.; Muthevhuli, M.; Faro, A.; A Gehring, C.; Iwuoha, E. Characterization and Expression Analysis of Heme Oxygenase Genes from Sorghum bicolor. Bioinform. Biol. Insights 2019, 13, 1177932219860813. [Google Scholar] [CrossRef] [PubMed]
- Martins, P.N.A.; Reutzel-Selke, A.; Jurisch, A.; Denecke, C.; Attrot, K.; Pascher, A.; Kotsch, K.; Pratschke, J.; Neuhaus, P.; Volk, H.-D.; et al. Induction of Carbon Monoxide in Donor Animals Prior to Organ Procurement Reduces Graft Immunogenicity and Inhibits Chronic Allograft Dysfunction. Transplantation 2006, 82, 938–944. [Google Scholar] [CrossRef] [PubMed]
- Feng, W.; Feng, G. A readily available colorimetric and near-infrared fluorescent turn-on probe for detection of carbon monoxide in living cells and animals. Sens. Actuators B Chem. 2018, 255, 2314–2320. [Google Scholar] [CrossRef]
- Jia, R.; Song, P.; Wang, J.; Mai, H.; Li, S.; Cheng, Y.; Wu, S. Self-Assembled Fluorescent Nanoprobe Based on Forster Resonance Energy Transfer for Carbon Monoxide in Living Cells and Animals via Ligand Exchange. Anal. Chem. 2018, 90, 7117–7121. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Liao, W. Carbon Monoxide as a Signaling Molecule in Plants. Front. Plant Sci. 2016, 7, 572. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Zhang, W.; Qi, F.; Cui, W.; Xie, Y.; Shen, W. Hydrogen-rich water regulates cucumber adventitious root development in a heme oxygenase-1/carbon monoxide-dependent manner. J. Plant Physiol. 2014, 171, 1–8. [Google Scholar] [CrossRef]
- Cao, Z.; Xuan, W.; Liu, Z.; Li, X.; Zhao, N.; Xu, P.; Wang, Z.; Guan, R.; Shen, W. Carbon Monoxide Promotes Lateral Root Formation in Rapeseed. J. Integr. Plant Biol. 2007, 49, 1070–1079. [Google Scholar] [CrossRef]
- Gahir, S.; Bharath, P.; Raghavendra, A. The role of gasotransmitters in movement of stomata: Mechanisms of action and importance for plant immunity. Biol. Plant. 2020, 64, 623–632. [Google Scholar] [CrossRef]
- Wu, M.; Huang, J.; Xu, S.; Ling, T.; Xie, Y.; Shen, W. Haem oxygenase delays programmed cell death in wheat aleurone layers by modulation of hydrogen peroxide metabolism. J. Exp. Bot. 2010, 62, 235–248. [Google Scholar] [CrossRef]
- Zhang, C.; Li, Y.; Yuan, F.; Hu, S.; He, P. Effects of hematin and carbon monoxide on the salinity stress responses of Cassia obtusifolia L. seeds and seedlings. Plant Soil 2012, 359, 85–105. [Google Scholar] [CrossRef]
- Sa, Z.; Huang, L.; Wu, G.; Ding, J.; Chen, X.; Yu, T.; Shi, C.; Shen, W. Carbon Monoxide: A Novel Antioxidant Against Oxidative Stress in Wheat Seedling Leaves. J. Integr. Plant Biol. 2007, 49, 638–645. [Google Scholar] [CrossRef]
- Xu, S.; Sa, Z.-S.; Cao, Z.-Y.; Xuan, W.; Huang, B.-K.; Ling, T.-F.; Hu, Q.-Y.; Shen, W.-B. Carbon Monoxide Alleviates Wheat Seed Germination Inhibition and Counteracts Lipid Peroxidation Mediated by Salinity. J. Integr. Plant Biol. 2006, 48, 1168–1176. [Google Scholar] [CrossRef]
- Huang, B.; Xu, S.; Xuan, W.; Li, M.; Cao, Z.; Liu, K.; Ling, T.; Shen, W. Carbon Monoxide Alleviates Salt-Induced Oxidative Damage in Wheat Seedling Leaves. J. Integr. Plant Biol. 2006, 48, 249–254. [Google Scholar] [CrossRef]
- Liu, K.; Xu, S.; Xuan, W.; Ling, T.; Cao, Z.; Huang, B.; Sun, Y.; Fang, L.; Liu, Z.; Zhao, N.; et al. Carbon monoxide counteracts the inhibition of seed germination and alleviates oxidative damage caused by salt stress in Oryza sativa. Plant Sci. 2007, 172, 544–555. [Google Scholar] [CrossRef]
- Amooaghaie, R.; Tabatabaei, F.; Ahadi, A. Alterations in HO-1 expression, heme oxygenase activity and endogenous NO homeostasis modulate antioxidant responses of Brassica nigra against nano silver toxicity. J. Plant Physiol. 2018, 228, 75–84. [Google Scholar] [CrossRef] [PubMed]
- Parihar, P.; Singh, S.; Singh, R.; Singh, V.P.; Prasad, S.M. Effect of salinity stress on plants and its tolerance strategies: A review. Environ. Sci. Pollut. Res. 2014, 22, 4056–4075. [Google Scholar] [CrossRef]
- Oliveira, S.R.; Queiroga, C.S.F.; Vieira, H.L.A. Mitochondria and carbon monoxide: Cytoprotection and control of cell metabolism—A role for Ca2+? J. Physiol. 2015, 594, 4131–4138. [Google Scholar] [CrossRef]
- Kolupaev, Y.E. Gasotransmitter Carbon Monoxide: Synthesis and Functions in Plants. Russ. J. Plant Physiol. 2022, 69, 42. [Google Scholar] [CrossRef]
- Sharma, P.; Jha, A.B.; Dubey, R.S.; Pessarakli, M. Reactive Oxygen Species, Oxidative Damage, and Antioxidative Defense Mechanism in Plants under Stressful Conditions. J. Bot. 2012, 2012, 217037. [Google Scholar] [CrossRef]
- Černý, M.; Habánová, H.; Berka, M.; Luklová, M.; Brzobohatý, B. Hydrogen Peroxide: Its Role in Plant Biology and Crosstalk with Signalling Networks. Int. J. Mol. Sci. 2018, 19, 2812. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Rodrigues, V.; Verma, S.; Singh, M.; Hiremath, C.; Shanker, K.; Shukla, A.K.; Sundaresan, V. Effect of salt stress on seed germination, morphology, biochemical parameters, genomic template stability, and bioactive constituents of Andrographis paniculata Nees. Acta Physiol. Plant. 2021, 43, 63. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, M.; Hu, L.; Liao, W.; Dawuda, M.M.; Li, C. Carbon Monoxide Is Involved in Hydrogen Gas-Induced Adventitious Root Development in Cucumber under Simulated Drought Stress. Front. Plant Sci. 2017, 8, 128. [Google Scholar] [CrossRef] [PubMed]
- Su, M.; Li, X.-F.; Ma, X.-Y.; Peng, X.-J.; Zhao, A.-G.; Cheng, L.-Q.; Chen, S.-Y.; Liu, G.-S. Cloning two P5CS genes from bioenergy sorghum and their expression profiles under abiotic stresses and MeJA treatment. Plant Sci. 2011, 181, 652–659. [Google Scholar] [CrossRef]
- Pakzad, R.; Goharrizi, K.J.; Riahi-Madvar, A.; Amirmahani, F.; Mortazavi, M.; Esmaeeli, L. Identification of Lepidium draba Δ1-pyrroline-5-carboxylate Synthetase (P5CS) and Assessment of its Expression Under NaCl stress: P5CS Identification in L. draba plant. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2021, 91, 195–203. [Google Scholar] [CrossRef]
- Shkliarevskyi, M.A.; Kolupaev, Y.E.; Yastreb, T.O.; Karpets, Y.V.; Dmitriev, A.P. The effect of CO donor hemin on the antioxidant and osmoprotective systems state in Arabidopsis of a wild-type and mutants defective in jasmonate signaling under salt stress. Ukr. Biochem. J. 2021, 93, 39–48. [Google Scholar] [CrossRef]
- Ashraf, M.; Foolad, M.R. Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 2007, 59, 206–216. [Google Scholar] [CrossRef]
- Reddy, P.S.; Jogeswar, G.; Rasineni, G.K.; Maheswari, M.; Reddy, A.R.; Varshney, R.K.; Kishor, P.K. Proline over-accumulation alleviates salt stress and protects photosynthetic and antioxidant enzyme activities in transgenic sorghum [Sorghum bicolor (L.) Moench]. Plant Physiol. Biochem. 2015, 94, 104–113. [Google Scholar] [CrossRef]
- Yuan, X.-X.; Wang, J.; Xie, Y.-J.; Shen, W.-B. Effects of carbon monoxide on salt tolerance and proline content of roots in wheat seedling. Plant Physiol. Commun. 2009, 45, 567–570. [Google Scholar]
- Xu, H.; Giannetti, A.; Sugiyama, Y.; Zheng, W.; Schneider, R.; Watanabe, Y.; Oda, Y.; Persson, S. Secondary cell wall patterning—Connecting the dots, pits and helices. Open Biol. 2022, 12, 210208. [Google Scholar] [CrossRef]
- Hasanuzzaman, M.; Fujita, M. Plant Responses and Tolerance to Salt Stress: Physiological and Molecular Interventions. Int. J. Mol. Sci. 2022, 23, 4810. [Google Scholar] [CrossRef]
- Li, S.; Wang, J.; Yin, Y.; Li, X.; Deng, L.; Jiang, X.; Chen, Z.; Li, Y. Investigating Effects of Bordered Pit Membrane Morphology and Properties on Plant Xylem Hydraulic Functions—A Case Study from 3D Reconstruction and Microflow Modelling of Pit Membranes in Angiosperm Xylem. Plants 2020, 9, 231. [Google Scholar] [CrossRef]
- Zhao, C.; Zhang, H.; Song, C.; Zhu, J.-K.; Shabala, S. Mechanisms of Plant Responses and Adaptation to Soil Salinity. Innovation 2020, 1, 100017. [Google Scholar] [CrossRef]
- Shen, Z.; Pu, X.; Wang, S.; Dong, X.; Cheng, X.; Cheng, M. Silicon improves ion homeostasis and growth of liquorice under salt stress by reducing plant Na+ uptake. Sci. Rep. 2022, 12, 5089. [Google Scholar] [CrossRef]
- Asgharipour, M.R.; Heidari, M. Effect of potassium supply on drought resistance in sorghum: Plant growth and macronutrient content. Pak. J. Agric. Sci. 2011, 48, 197–204. [Google Scholar]
- Lu, K.; Ding, W.; Zhu, S.; Jiang, D. Salt-induced difference between Glycine cyrtoloba and G. max in anti-oxidative ability and K+ vs. Na+ selective accumulation. Crop. J. 2016, 4, 129–138. [Google Scholar] [CrossRef]
- Verma, K.; Dixit, S.; Shekhawat, G.S.; ALAM, A. Antioxidant activity of heme oxygenase 1 in Brassica juncea (L.) Czern. (Indian mustard) under salt stress. Turk. J. Biol. 2015, 39, 540–549. [Google Scholar] [CrossRef]
- Sarker, U.; Oba, S. The Response of Salinity Stress-Induced A. tricolor to Growth, Anatomy, Physiology, Non-Enzymatic and Enzymatic Antioxidants. Front. Plant Sci. 2020, 11, 559876. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.-Q.; Hua, Y.-P.; Zhou, T.; Liu, Y.; Huang, J.-Y.; Yue, C.-P. Global Landscapes of the Na+/H+ Antiporter (NHX) Family Members Uncover their Potential Roles in Regulating the Rapeseed Resistance to Salt Stress. Int. J. Mol. Sci. 2020, 21, 3429. [Google Scholar] [CrossRef] [PubMed]
- Bulle, M.; Yarra, R.; Abbagani, S. Enhanced salinity stress tolerance in transgenic chilli pepper (Capsicum annuum L.) plants overexpressing the wheat antiporter (TaNHX2) gene. Mol. Breed. 2016, 36, 36. [Google Scholar] [CrossRef]
- Akram, U.; Song, Y.; Liang, C.; Abid, M.A.; Askari, M.; Myat, A.A.; Abbas, M.; Malik, W.; Ali, Z.; Guo, S.; et al. Genome-Wide Characterization and Expression Analysis of NHX Gene Family under Salinity Stress in Gossypium barbadense and Its Comparison with Gossypium hirsutum. Genes 2020, 11, 803. [Google Scholar] [CrossRef]
- Jabeen, Z.; Irshad, F.; Hussain, N.; Han, Y.; Zhang, G. NHX-Type Na+/H+ Antiporter Gene Expression Under Different Salt Levels and Allelic Diversity of HvNHX in Wild and Cultivated Barleys. Front. Genet. 2022, 12, 809988. [Google Scholar] [CrossRef] [PubMed]
- Almeida, D.M.; Oliveira, M.M.; Saibo, N.J.M. Regulation of Na+ and K+ homeostasis in plants: Towards improved salt stress tolerance in crop plants. Genet. Mol. Biol. 2017, 40 (Suppl. S1), 326–345. [Google Scholar] [CrossRef]
- Balasubramaniam, T.; Shen, G.; Esmaeili, N.; Zhang, H. Plants’ Response Mechanisms to Salinity Stress. Plants 2023, 12, 2253. [Google Scholar] [CrossRef]
- Westworth, S.; Ashwath, N.; Cozzolino, D. Application of FTIR-ATR spectroscopy to detect salinity response in Beauty Leaf Tree (Calophyllum inophyllum L). Energy Procedia 2019, 160, 761–768. [Google Scholar] [CrossRef]
- Xu, D.-K.; Jin, Q.-J.; Xie, Y.-J.; Liu, Y.-H.; Lin, Y.-T.; Shen, W.-B.; Zhou, Y.-J. Characterization of a Wheat Heme Oxygenase-1 Gene and Its Responses to Different Abiotic Stresses. Int. J. Mol. Sci. 2011, 12, 7692–7707. [Google Scholar] [CrossRef] [PubMed]
- Zilli, C.G.; Balestrasse, K.B.; Yannarelli, G.G.; Polizio, A.H.; Santa-Cruz, D.M.; Tomaro, M.L. Heme oxygenase up-regulation under salt stress protects nitrogen metabolism in nodules of soybean plants. Environ. Exp. Bot. 2008, 64, 83–89. [Google Scholar] [CrossRef]
- Christou, A.; Manganaris, G.A.; Papadopoulos, I.; Fotopoulos, V. Hydrogen sulfide induces systemic tolerance to salinity and non-ionic osmotic stress in strawberry plants through modification of reactive species biosynthesis and transcriptional regulation of multiple defence pathways. J. Exp. Bot. 2013, 64, 1953–1966. [Google Scholar] [CrossRef] [PubMed]
- Zheng, M.; Liu, Y.; Zhang, G.; Yang, Z.; Xu, W.; Chen, Q. The Applications and Mechanisms of Superoxide Dismutase in Medicine, Food, and Cosmetics. Antioxidants 2023, 12, 1675. [Google Scholar] [CrossRef]
- Kader, M.A. A Comparison of Seed Germination Calculation Formulae and the Associated Interpretation of Resulting Data. J. Proc. R. Soc. N. S. W. 2005, 138, 65–75. [Google Scholar] [CrossRef]
- Zhang, Z.; Wei, Y.; Collinge, D.B.; Thordal-Christensen, H. Subcellular localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive response during the barley—Powdery mildew interaction. Plant J. 1997, 11, 1187–1194. [Google Scholar] [CrossRef]
- Junglee, S.; Urban, L.; Sallanon, H.; Lopez-Lauri, F. Optimized Assay for Hydrogen Peroxide Determination in Plant Tissue Using Potassium Iodide. Am. J. Anal. Chem. 2014, 5, 730–736. [Google Scholar] [CrossRef]
- Sithtisarn, S.; Harinasut, P.; Pornbunlualap, S.; Cha-Um, S.; Carillo, P.; Gibon, Y. PROTOCOL: Extraction and determination of glycine betaine Initiating Author Name. Kasetsart J. Nat. Sci. 2009, 43, 146–152. [Google Scholar]
- Pakkirisamy, M.; Kalakandan, S.K.; Ravichandran, K. Phytochemical Screening, GC-MS, FT-IR Analysis of Methanolic Extract of Curcuma caesia Roxb (Black Turmeric). Pharmacogn. J. 2017, 9, 952–956. [Google Scholar] [CrossRef]
- Lecube, M.L.; Noriega, G.O.; Cruz, D.M.S.; Tomaro, M.L.; Batlle, A.; Balestrasse, K.B. Indole acetic acid is responsible for protection against oxidative stress caused by drought in soybean plants: The role of heme oxygenase induction. Redox Rep. 2014, 19, 242–250. [Google Scholar] [CrossRef]
- Wang, W.; Vignani, R.; Scali, M.; Cresti, M. A universal and rapid protocol for protein extraction from recalcitrant plant tissues for proteomic analysis. Electrophoresis 2006, 27, 2782–2786. [Google Scholar] [CrossRef] [PubMed]
- Fanger, B.O. Adaptation of the Bradford protein assay to membrane-bound proteins by solubilizing in glucopyranoside detergents. Anal. Biochem. 1987, 162, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Ndimba, B.K.; Thomas, L.A.; Ngara, R. Sorghum 2-dimensional proteome profiles and analysis of HSP70 expression under salinity stress. Kasetsart J. Nat. Sci. 2010, 44, 768–775. [Google Scholar]
- Amooaghaie, R.; Tabatabaie, F. Osmopriming-induced salt tolerance during seed germination of alfalfa most likely mediates through H2O2 signaling and upregulation of heme oxygenase. Protoplasma 2017, 254, 1791–1803. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Accession Number |
---|---|---|---|
SbP5CS1 | CCTCTTCCCAGCTTCTTGTG | TAGCCAGAAGACCGGCTAAA | XM_021447400.1 |
SbHO1 | TTCCAGACGCTCGAAGACAT | CCTGGGGATCCTTCTCAGAC | XM_002438597.2 |
SbNHX4 | CATGCCACCATCATCACCAG | CTCCAAGACAATACCGCTGC | XM_021448959.1 |
SbKT1 | TCCCAAAGATCAGCTGCTCA | ACGCCACTCACACAGACTTA | XM_002446325.1 |
SbFeSOD | TACGGTCTCACAACTCCACC | CAGACCTGTGCTGCATTGTT | XM_002436411.2 |
SbMnSOD | CCTTTCCCCTCCTCCATCTC | GAAGTCGTAGGAGAGGTCGG | XM_002439497.2 |
SbCAT | GGTTCGCCGTCAAGTTCTAC | AAGAAGGTGTGGAGGCTCTC | XM_021460018.1 |
18S rRNA | GCCAAGATTCAGGATAAG | TTGTAATCAGCCAATGTG | XM_002452660 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ikebudu, V.C.; Nkuna, M.; Ndou, N.; Ajayi, R.F.; Chivasa, S.; Cornish, K.; Mulaudzi, T. Carbon Monoxide Alleviates Salt-Induced Oxidative Damage in Sorghum bicolor by Inducing the Expression of Proline Biosynthesis and Antioxidant Genes. Plants 2024, 13, 782. https://doi.org/10.3390/plants13060782
Ikebudu VC, Nkuna M, Ndou N, Ajayi RF, Chivasa S, Cornish K, Mulaudzi T. Carbon Monoxide Alleviates Salt-Induced Oxidative Damage in Sorghum bicolor by Inducing the Expression of Proline Biosynthesis and Antioxidant Genes. Plants. 2024; 13(6):782. https://doi.org/10.3390/plants13060782
Chicago/Turabian StyleIkebudu, Vivian Chigozie, Mulisa Nkuna, Nzumbululo Ndou, Rachel Fanelwa Ajayi, Stephen Chivasa, Katrina Cornish, and Takalani Mulaudzi. 2024. "Carbon Monoxide Alleviates Salt-Induced Oxidative Damage in Sorghum bicolor by Inducing the Expression of Proline Biosynthesis and Antioxidant Genes" Plants 13, no. 6: 782. https://doi.org/10.3390/plants13060782