Comparison of the Morpho-Physiological and Molecular Responses to Salinity and Alkalinity Stresses in Rice
Abstract
:1. Introduction
2. Results
2.1. The Performance of Rice Genotypes under Saline and Alkaline Stress
2.2. Analysis of Morpho-Physiological Traits under Saline and Alkaline Stress: A Comprehensive Examination
2.3. The Differential Expression of Stress-Responsive Genes under Saline and Alkaline Conditions
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Evaluation of Salinity and Alkalinity Tolerance
4.3. Visual Salt Injury Score (SIS)
4.4. Chlorophyll Content (SPAD Reading)
4.5. Growth Parameters
4.6. Measurement of Na+ and K+
4.7. Expression Analysis of Selected Genes
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gu, D.; Zhen, F.; Hannaway, D.B.; Zhu, Y.; Liu, L.; Cao, W.; Tang, L. Quantitative Classification of Rice (Oryza sativa L.) Root Length and Diameter Using Image Analysis. PLoS ONE 2017, 12, e0169968. [Google Scholar] [CrossRef] [PubMed]
- Kakar, N.; Jumaa, S.H.; Redoña, E.D.; Warburton, M.L.; Reddy, K.R. Evaluating Rice for Salinity Using Pot-Culture Provides a Systematic Tolerance Assessment at the Seedling Stage. Rice 2019, 12, 57. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Czechowski, T.; Graham, I.A.; Hartley, S.E. Impact of Osmotic Stress on the Growth and Root Architecture of Introgression Lines Derived from a Wild Ancestor of Rice and a Modern Cultivar. Plant Environ. Interact. 2020, 1, 122–133. [Google Scholar] [CrossRef] [PubMed]
- Qu, M.; Zheng, G.; Hamdani, S.; Essemine, J.; Song, Q.; Wang, H.; Chu, C.; Sirault, X.; Zhu, X.-G. Leaf Photosynthetic Parameters Related to Biomass Accumulation in a Global Rice Diversity Survey. Plant Physiol. 2017, 175, 248–258. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; He, N.; Hou, J.; Xu, L.; Liu, C.; Zhang, J.; Wang, Q.; Zhang, X.; Wu, X. Factors Influencing Leaf Chlorophyll Content in Natural Forests at the Biome Scale. Front. Ecol. Evol. 2018, 6, 64. [Google Scholar] [CrossRef]
- Tsai, Y.-C.; Chen, K.-C.; Cheng, T.-S.; Lee, C.; Lin, S.-H.; Tung, C.-W. Chlorophyll Fluorescence Analysis in Diverse Rice Varieties Reveals the Positive Correlation between the Seedlings Salt Tolerance and Photosynthetic Efficiency. BMC Plant Biol. 2019, 19, 403. [Google Scholar] [CrossRef] [PubMed]
- Hussain, S.; Zhang, J.-H.; Zhong, C.; Zhu, L.-F.; Cao, X.-C.; Yu, S.-M.; Allen Bohr, J.; Hu, J.-J.; Jin, Q.-Y. Effects of Salt Stress on Rice Growth, Development Characteristics, and the Regulating Ways: A Review. J. Integr. Agric. 2017, 16, 2357–2374. [Google Scholar] [CrossRef]
- Zhang, H.; Liu, X.-L.; Zhang, R.-X.; Yuan, H.-Y.; Wang, M.-M.; Yang, H.-Y.; Ma, H.-Y.; Liu, D.; Jiang, C.-J.; Liang, Z.-W. Root Damage under Alkaline Stress Is Associated with Reactive Oxygen Species Accumulation in Rice (Oryza sativa L.). Front. Plant Sci. 2017, 8, 1580. [Google Scholar] [CrossRef]
- Ma, C.; Yuan, S.; Xie, B.; Li, Q.; Wang, Q.; Shao, M. IAA Plays an Important Role in Alkaline Stress Tolerance by Modulating Root Development and ROS Detoxifying Systems in Rice Plants. Int. J. Mol. Sci. 2022, 23, 14817. [Google Scholar] [CrossRef]
- Munns, R.; Tester, M. Mechanisms of Salinity Tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef]
- Zhao, C.; Zhang, H.; Song, C.; Zhu, J.-K.; Shabala, S. Mechanisms of Plant Responses and Adaptation to Soil Salinity. Innovation 2020, 1, 100017. [Google Scholar] [CrossRef]
- Verslues, P.E.; Agarwal, M.; Katiyar-Agarwal, S.; Zhu, J.; Zhu, J.-K. Methods and Concepts in Quantifying Resistance to Drought, Salt and Freezing, Abiotic Stresses That Affect Plant Water Status. Plant J. 2006, 45, 523–539. [Google Scholar] [CrossRef] [PubMed]
- Horie, T.; Hauser, F.; Schroeder, J.I. HKT Transporter-Mediated Salinity Resistance Mechanisms in Arabidopsis and Monocot Crop Plants. Trends Plant Sci. 2009, 14, 660–668. [Google Scholar] [CrossRef] [PubMed]
- Rubio, F.; Nieves-Cordones, M.; Horie, T.; Shabala, S. Doing ‘Business as Usual’ Comes with a Cost: Evaluating Energy Cost of Maintaining Plant Intracellular K+ Homeostasis under Saline Conditions. New Phytol. 2020, 225, 1097–1104. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Jing, W.; Xiao, L.; Jin, Y.; Shen, L.; Zhang, W. The Rice High-Affinity Potassium Transporter1;1 Is Involved in Salt Tolerance and Regulated by an MYB-Type Transcription Factor. Plant Physiol. 2015, 168, 1076–1090. [Google Scholar] [CrossRef] [PubMed]
- Campbell, M.T.; Bandillo, N.; Al Shiblawi, F.R.A.; Sharma, S.; Liu, K.; Du, Q.; Schmitz, A.J.; Zhang, C.; Véry, A.-A.; Lorenz, A.J.; et al. Allelic Variants of OsHKT1;1 Underlie the Divergence between Indica and Japonica Subspecies of Rice (Oryza sativa) for Root Sodium Content. PLoS Genet. 2017, 13, e1006823. [Google Scholar] [CrossRef] [PubMed]
- Sunarpi; Horie, T.; Motoda, J.; Kubo, M.; Yang, H.; Yoda, K.; Horie, R.; Chan, W.-Y.; Leung, H.-Y.; Hattori, K.; et al. Enhanced Salt Tolerance Mediated by AtHKT1 Transporter-induced Na+ Unloading from Xylem Vessels to Xylem Parenchyma Cells. Plant J. 2005, 44, 928–938. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Atienza, J.; Jiang, X.; Garciadeblas, B.; Mendoza, I.; Zhu, J.-K.; Pardo, J.M.; Quintero, F.J. Conservation of the Salt Overly Sensitive Pathway in Rice. Plant Physiol. 2007, 143, 1001–1012. [Google Scholar] [CrossRef]
- Møller, I.S.; Gilliham, M.; Jha, D.; Mayo, G.M.; Roy, S.J.; Coates, J.C.; Haseloff, J.; Tester, M. Shoot Na+ Exclusion and Increased Salinity Tolerance Engineered by Cell Type–Specific Alteration of Na+ Transport in Arabidopsis. Plant Cell 2009, 21, 2163–2178. [Google Scholar] [CrossRef]
- Ren, Z.-H.; Gao, J.-P.; Li, L.-G.; Cai, X.-L.; Huang, W.; Chao, D.-Y.; Zhu, M.-Z.; Wang, Z.-Y.; Luan, S.; Lin, H.-X. A Rice Quantitative Trait Locus for Salt Tolerance Encodes a Sodium Transporter. Nat. Genet. 2005, 37, 1141–1146. [Google Scholar] [CrossRef]
- Platten, J.D.; Egdane, J.A.; Ismail, A.M. Salinity Tolerance, Na+ Exclusion and Allele Mining of HKT1; 5 in Oryza sativa and O. glaberrima: Many Sources, Many Genes, One Mechanism? BMC Plant Biol. 2013, 13, 32. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Xie, G.; Liu, Z.; He, R.; Han, J.; Huang, S.; Liu, L.; Cheng, X. Mutagenesis Reveals That the OsPPa6 Gene Is Required for Enhancing the Alkaline Tolerance in Rice. Front. Plant Sci. 2019, 10, 759. [Google Scholar] [CrossRef] [PubMed]
- Moon, H.; Kim, Y.-A.; Shin, R.; Park, C.-J. Nucleus-Encoded Thylakoid Protein, OsY3IP1, Confers Enhanced Tolerance to Saline and Alkaline Stresses in Rice. Rice Sci. 2022, 29, 225–236. [Google Scholar] [CrossRef]
- Subudhi, P.K.; Shankar, R.; Jain, M. Whole Genome Sequence Analysis of Rice Genotypes with Contrasting Response to Salinity Stress. Sci. Rep. 2020, 10, 1259. [Google Scholar] [CrossRef] [PubMed]
- Ketehouli, T.; Idrice Carther, K.F.; Noman, M.; Wang, F.-W.; Li, X.-W.; Li, H.-Y. Adaptation of Plants to Salt Stress: Characterization of Na+ and K+ Transporters and Role of CBL Gene Family in Regulating Salt Stress Response. Agronomy 2019, 9, 687. [Google Scholar] [CrossRef]
- Farooq, M.; Park, J.-R.; Jang, Y.-H.; Kim, E.-G.; Kim, K.-M. Rice Cultivars under Salt Stress Show Differential Expression of Genes Related to the Regulation of Na+/K+ Balance. Front. Plant Sci. 2021, 12, 680131. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.-B.; Liu, C.; Tang, D.-Y.; Yan, L.; Wang, D.; Yang, Y.-Z.; Gui, J.-S.; Zhao, X.-Y.; Li, L.-G.; Tang, X.-D.; et al. The Receptor-like Cytoplasmic Kinase STRK1 Phosphorylates and Activates CatC, Thereby Regulating H2O2 Homeostasis and Improving Salt Tolerance in Rice. Plant Cell 2018, 30, 1100–1118. [Google Scholar] [CrossRef]
- Pruthi, R.; Chapagain, S.; Coronejo, S.; Singh, L.; Subudhi, P.K. Quantitative Trait Loci, Candidate Genes, and Breeding Lines to Improve Salt Tolerance at the Flowering and Seedling Stages in Rice. Food Energy Secur. 2022, 12, e433. [Google Scholar] [CrossRef]
- Xu, N.; Chu, Y.; Chen, H.; Li, X.; Wu, Q.; Jin, L.; Wang, G.; Huang, J. Rice Transcription Factor OsMADS25 Modulates Root Growth and Confers Salinity Tolerance via the ABA-Mediated Regulatory Pathway and ROS Scavenging. PLoS Genet. 2018, 14, e1007662. [Google Scholar] [CrossRef]
- Ren, X.; Fan, J.; Li, X.; Shan, Y.; Wang, L.; Ma, L.; Li, Y.; Li, X. Application of RNA Sequencing to Understand the Response of Rice Seedlings to Salt-Alkali Stress. BMC Genom. 2023, 24, 21. [Google Scholar] [CrossRef]
- Mei, S.; Zhang, G.; Jiang, J.; Lu, J.; Zhang, F. Combining Genome-Wide Association Study and Gene-Based Haplotype Analysis to Identify Candidate Genes for Alkali Tolerance at the Germination Stage in Rice. Front. Plant Sci. 2022, 13, 887239. [Google Scholar] [CrossRef]
- Singh, L.; Coronejo, S.; Pruthi, R.; Chapagain, S.; Subudhi, P.K. Integration of QTL Mapping and Whole Genome Sequencing Identifies Candidate Genes for Alkalinity Tolerance in Rice (Oryza sativa). Int. J. Mol. Sci. 2022, 23, 11791. [Google Scholar] [CrossRef] [PubMed]
- Singh, L.; Coronejo, S.; Pruthi, R.; Chapagain, S.; Bhattarai, U.; Subudhi, P.K. Genetic Dissection of Alkalinity Tolerance at the Seedling Stage in Rice (Oryza sativa) Using a High-Resolution Linkage Map. Plants 2022, 11, 3347. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Yang, A.; Zhang, W.-H. Efficient Acquisition of Iron Confers Greater Tolerance to Saline-Alkaline Stress in Rice (Oryza sativa L.). J. Exp. Bot. 2016, 67, 6431–6444. [Google Scholar] [CrossRef] [PubMed]
- Ogo, Y.; Itai, R.N.; Kobayashi, T.; Aung, M.S.; Nakanishi, H.; Nishizawa, N.K. OsIRO2 Is Responsible for Iron Utilization in Rice and Improves Growth and Yield in Calcareous Soil. Plant Mol. Biol. 2011, 75, 593–605. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Zheng, H.; Cui, J.; Wang, J.; Liu, H.; Sun, J.; Liu, T.; Zhao, H.; Lai, Y.; Zou, D. Genome-Wide Association Study and Candidate Gene Analysis of Alkalinity Tolerance in Japonica Rice Germplasm at the Seedling Stage. Rice 2019, 12, 24. [Google Scholar] [CrossRef] [PubMed]
- Razzaque, S.; Elias, S.M.; Haque, T.; Biswas, S.; Jewel, G.M.N.A.; Rahman, S.; Weng, X.; Ismail, A.M.; Walia, H.; Juenger, T.E.; et al. Gene Expression Analysis Associated with Salt Stress in a Reciprocally Crossed Rice Population. Sci. Rep. 2019, 9, 8249. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.-S.; Chen, X.-Y.; Yang, K.; Sun, Z.-X.; Fu, Y.-P.; Zhang, Y.-M.; Fang, R.-X. Overexpression of an F-Box Protein Gene Reduces Abiotic Stress Tolerance and Promotes Root Growth in Rice. Mol. Plant 2011, 4, 190–197. [Google Scholar] [CrossRef] [PubMed]
- Guan, Q.J.; Ma, H.Y.; Wang, Z.J.; Wang, Z.Y.; Bu, Q.Y.; Liu, S.K. A Rice LSD1-like-Type ZFP Gene OsLOL5 Enhances Saline-Alkaline Tolerance in Transgenic Arabidopsis Thaliana, Yeast and Rice. BMC Genom. 2016, 17, 142. [Google Scholar] [CrossRef]
- De Leon, T.B.; Linscombe, S.; Subudhi, P.K. Identification and Validation of QTLs for Seedling Salinity Tolerance in Introgression Lines of a Salt Tolerant Rice Landrace ‘Pokkali’. PLoS ONE 2017, 12, e0175361. [Google Scholar] [CrossRef]
- Kanawapee, N.; Sanitchon, J.; Srihaban, P.; Theerakulpisut, P. Physiological Changes during Development of Rice (Oryza sativa L.) Varieties Differing in Salt Tolerance under Saline Field Condition. Plant Soil 2013, 370, 89–101. [Google Scholar] [CrossRef]
- Wang, X.; Wang, J.; Liu, H.; Zou, D.; Zhao, H. Influence of Natural Saline-Alkali Stress on Chlorophyll Content and Chloroplast Ultrastructure of Two Contrasting Rice (Oryza sativa L. Japonica) Cultivars. Aust. J. Crop Sci. 2013, 7, 289–292. [Google Scholar]
- Chang, J.; Cheong, B.E.; Natera, S.; Roessner, U. Morphological and Metabolic Responses to Salt Stress of Rice (Oryza sativa L.) Cultivars Which Differ in Salinity Tolerance. Plant Physiol. Biochem. 2019, 144, 427–435. [Google Scholar] [CrossRef] [PubMed]
- Rasel, M.; Tahjib-Ul-Arif, M.; Hossain, M.A.; Hassan, L.; Farzana, S.; Brestic, M. Screening of Salt-Tolerant Rice Landraces by Seedling Stage Phenotyping and Dissecting Biochemical Determinants of Tolerance Mechanism. J. Plant Growth Regul. 2021, 40, 1853–1868. [Google Scholar] [CrossRef]
- Ganapati, R.K.; Naveed, S.A.; Zafar, S.; Wang, W.; Xu, J. Saline-Alkali Tolerance in Rice: Physiological Response, Molecular Mechanism, and QTL Identification and Application to Breeding. Rice Sci. 2022, 29, 412–434. [Google Scholar] [CrossRef]
- Peng, Z.; He, S.; Sun, J.; Pan, Z.; Gong, W.; Lu, Y.; Du, X. Na+ Compartmentalization Related to Salinity Stress Tolerance in Upland Cotton (Gossypium Hirsutum) Seedlings. Sci. Rep. 2016, 6, 34548. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, P.M.; Bressan, R.A.; Zhu, J.-K.; Bohnert, H.J. Plant Cellular and Molecular Responses to High Salinity. Annu. Rev. Plant Physiol. Plant Mol. Biol. 2000, 51, 463–499. [Google Scholar] [CrossRef]
- Ratna, K.; Teresa, D.; Hanamareddy, B.; Prasanta, K.S. Salt Stress Induced Variation in DNA Methylation Pattern and Its Influence on Gene Expression in Contrasting Rice Genotypes. PLoS ONE 2012, 7, e40203. [Google Scholar] [CrossRef]
- Ganie, S.A.; Molla, K.A.; Henry, R.J.; Bhat, K.V.; Mondal, T.K. Advances in Understanding Salt Tolerance in Rice. Züchter Genet. Breed. Res. 2019, 132, 851–870. [Google Scholar] [CrossRef]
- Pental, D. When Scientists Turn against Science: Exceptionally Flawed Analysis of Plant Breeding Technologies. Curr. Sci. 2019, 117, 932. [Google Scholar] [CrossRef]
- Puram, V.R.R.; Ontoy, J.; Linscombe, S.; Subudhi, P.K. Genetic Dissection of Seedling Stage Salinity Tolerance in Rice Using Introgression Lines of a Salt Tolerant Landrace Nona Bokra. J. Hered. 2017, 108, 658–670. [Google Scholar] [CrossRef]
- Zörb, C.; Geilfus, C.-M.; Dietz, K.-J. Salinity and Crop Yield. Plant Biol. 2019, 21, 31–38. [Google Scholar] [CrossRef]
- Ge, Y.; Li, Y.; Zhu, Y.-M.; Bai, X.; Lv, D.-K.; Guo, D.; Ji, W.; Cai, H. Global Transcriptome Profiling of Wild Soybean (Glycine soja) Roots under NaHCO3treatment. BMC Plant Biol. 2010, 10, 153. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.-M.; Liu, X.-G.; Qu, X.-N.; Yu, Y.; Han, S.-P.; Dou, Y.; Xu, Y.-Y.; Jing, H.-C.; Hao, D.-Y. Early Transcriptomic Adaptation to Na2CO3 Stress Altered the Expression of a Quarter of the Total Genes in the Maize Genome and Exhibited Shared and Distinctive Profiles with NaCl and High PH Stresses: Early Transcriptomic Adaptation to Na2CO3 Stress in Maize Roots. J. Integr. Plant Biol. 2013, 55, 1147–1165. [Google Scholar] [CrossRef] [PubMed]
- He, R.; Yu, G.; Han, X.; Han, J.; Li, W.; Wang, B.; Huang, S.; Cheng, X. ThPP1 Gene, Encodes an Inorganic Pyrophosphatase in Thellungiella Halophila, Enhanced the Tolerance of the Transgenic Rice to Alkali Stress. Plant Cell Rep. 2017, 36, 1929–1942. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Ying, Y.; Wang, L.; Wang, F.; Whelan, J.; Shou, H. Identification of a Novel Iron Regulated Basic Helix-Loop-Helix Protein Involved in Fe Homeostasis in Oryza sativa. BMC Plant Biol. 2010, 10, 166. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, T.; Nakanishi Itai, R.; Nishizawa, N.K. Iron Deficiency Responses in Rice Roots. Rice 2014, 7, 27. [Google Scholar] [CrossRef] [PubMed]
- El Mahi, H.; Pérez-Hormaeche, J.; De Luca, A.; Villalta, I.; Espartero, J.; Gámez-Arjona, F.; Fernández, J.L.; Bundó, M.; Mendoza, I.; Mieulet, D.; et al. A Critical Role of Sodium Flux via the Plasma Membrane Na+/H+ Exchanger SOS1 in the Salt Tolerance of Rice. Plant Physiol. 2019, 180, 1046–1065. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Shabala, S.; Shabala, L.; Zhou, M.; Meinke, H.; Venkataraman, G.; Chen, Z.; Zeng, F.; Zhao, Q. Tissue-Specific Regulation of Na+ and K+ Transporters Explains Genotypic Differences in Salinity Stress Tolerance in Rice. Front. Plant Sci. 2019, 10, 1361. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, T.; Hamamoto, S.; Uozumi, N. Sodium Transport System in Plant Cells. Front. Plant Sci. 2013, 4, 410. [Google Scholar] [CrossRef]
- Fukuda, A.; Nakamura, A.; Hara, N.; Toki, S.; Tanaka, Y. Molecular and Functional Analyses of Rice NHX-Type Na+/H+ Antiporter Genes. Planta 2011, 233, 175–188. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, K.; Chattaopadhyay, K.; Nayak, L.; Ray, S.; Yeasmin, L.; Jena, P.; Gupta, S.; Mohanty, S.K.; Swain, P.; Sarkar, R.K. Ionic Selectivity and Coordinated Transport of Na+ and K+ in Flag Leaves Render Differential Salt Tolerance in Rice at the Reproductive Stage. Planta 2019, 250, 1637–1653. [Google Scholar] [CrossRef] [PubMed]
- Horie, T.; Yoshida, K.; Nakayama, H.; Yamada, K.; Oiki, S.; Shinmyo, A. Two Types of HKT Transporters with Different Properties of Na+ and K+ Transport in Oryza sativa. Plant J. 2001, 27, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Kader, M.A.; Seidel, T.; Golldack, D.; Lindberg, S. Expressions of OsHKT1, OsHKT2, and OsVHA Are Differentially Regulated under NaCl Stress in Salt-Sensitive and Salt-Tolerant Rice (Oryza sativa L.) Cultivars. J. Exp. Bot. 2006, 57, 4257–4268. [Google Scholar] [CrossRef] [PubMed]
- Golldack, D.; Su, H.; Quigley, F.; Kamasani, U.R.; Muñoz-Garay, C.; Balderas, E.; Popova, O.V.; Bennett, J.; Bohnert, H.J.; Pantoja, O. Characterization of a HKT-type Transporter in Rice as a General Alkali Cation Transporter. Plant J. 2002, 31, 529–542. [Google Scholar] [CrossRef] [PubMed]
- De Leon, T.B.; Linscombe, S.; Gregorio, G.; Subudhi, P.K. Genetic Variation in Southern USA Rice Genotypes for Seedling Salinity Tolerance. Front. Plant Sci. 2015, 6, 374. [Google Scholar] [CrossRef] [PubMed]
- Linscombe, S.D.; Jodari, F.; Mckenzie, K.S.; Bollich, P.K.; White, L.M.; Groth, D.E.; Dunand, R.T. Registration of ‘Bengal’ Rice. Crop Sci. 1993, 33, 645–646. [Google Scholar] [CrossRef]
- Oard, J.H.; Harrell, D.L.; Groth, D.E.; Bearb, K.F.; White, L.M., III; Linscombe, S.D. Registration of ‘Mermentau’ Rice. J. Plant Regist. 2014, 8, 135–138. [Google Scholar] [CrossRef]
- Gregorio, G.B.; Senadhira, D.; Mendoza, R.D. Screening Rice for Salinity Tolerance; International Rice Research Institute (IRRI): Los Baños, Philippines, 1997; No. 22; pp. 1–30. [CrossRef]
- Jones, J.B., Jr.; Case, V.W. Sampling, Handling, and Analyzing Plant Tissue Samples. In Soil Testing and Plant Analysis; SSSA Book Series; Soil Science Society of America: Madison, WI, USA, 2018; pp. 389–427. ISBN 9780891188629. [Google Scholar]
- Goodstein, D.M.; Shu, S.; Howson, R.; Neupane, R.; Hayes, R.D.; Fazo, J.; Mitros, T.; Dirks, W.; Hellsten, U.; Putnam, N.; et al. Phytozome: A Comparative Platform for Green Plant Genomics. Nucleic Acids Res. 2012, 40, D1178–D1186. [Google Scholar] [CrossRef]
- Subudhi, P.K.; Garcia, R.S.; Coronejo, S.; Tapia, R. Comparative Transcriptomics of Rice Genotypes with Contrasting Responses to Nitrogen Stress Reveals Genes Influencing Nitrogen Uptake through the Regulation of Root Architecture. Int. J. Mol. Sci. 2020, 21, 5759. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ripley, B.D. The R Project in Statistical Computing. MSOR Connect. 2001, 1, 23–25. [Google Scholar] [CrossRef]
Traits $ | Pokkali | Geumgangbyeo | Mermentau | Bengal | Trait Mean |
---|---|---|---|---|---|
SIS | 3.0 b ± 0.0 | 3.0 b ± 0.0 | 7.0 a ± 1.15 | 6.0 a ± 1.15 | 4.8 |
CHL (SPAD units) | 26.5 ab ± 01.7 | 27.9 a ± 1.95 | 21.0 c ± 1.23 | 22.9 bc ± 2.20 | 24.6 |
SL (cm) | 40.9 a ± 2.06 | 25.1 b ± 4.12 | 23.8 b ± 1.88 | 28.6 b ± 3.18 | 29.6 |
RL (cm) | 10.9 a ± 1.35 | 8.5 ab ± 1.45 | 6.7 b ± 0.53 | 9.7 ab ± 1.40 | 9 |
SNC (mmol kg−1) | 2218 a ± 108.35 | 2227 a ± 116.59 | 2214 a ± 106.01 | 2294 a ± 114.23 | 2238 |
SKC (mmol kg−1) | 619 b ± 114.3 | 685 b ± 132.68 | 548 b ± 51.40 | 715 b ± 82.36 | 642 |
RNC (mmol kg−1) | 1640 b ± 91.53 | 2333 ab ± 108.39 | 3365 a ± 166.32 | 3793 a ± 128.07 | 2783 |
RKC (mmol kg−1) | 799 ab ± 88.96 | 795 ab ±90.04 | 639 b ± 68.34 | 917 a ± 98.94 | 788 |
SNaK (ratio) | 3.7 a ±0.78 | 3.6 a ±0.49 | 4.0 a ±0.42 | 3.3 a ± 0.66 | 3.6 |
RNaK (ratio) | 2.2 b ± 0.45 | 3.0 ab ± 0.23 | 5.4 a ± 0.29 | 4.2 ab ± 0.27 | 3.7 |
Traits $ | Pokkali | Geumgangbyeo | Mermentau | Bengal | Trait Mean |
---|---|---|---|---|---|
SIS | 5.7 ab ± 1.15 | 3.3 b ± 0.57 | 7.7 a ± 1.15 | 4.3 b ± 1.15 | 5.3 |
CHL (SPAD units) | 4.7 ab ± 1.28 | 26.3 a ± 1.39 | 21.8 b ± 0.75 | 25.5 ab ± 1.52 | 24.6 |
SL (cm) | 35.7 a ± 2.29 | 25.6 b ± 1.82 | 14.9 c ± 0.94 | 23.8 b ± 0.23 | 25 |
RL (cm) | 9.0 a ± 1.3 | 7.1 a ± 0.87 | 4.3 b ± 0.66 | 8.0 a ± 0.66 | 7.1 |
SNC (mmol kg−1) | 2506 ab ± 130.34 | 2057 b ± 100.94 | 2923 a ± 45.00 | 2088 b ± 113.89 | 2394 |
SKC (mmol kg−1) | 1044 a ±140.51 | 794 a ± 45.4 | 1289 a ± 123.38 | 1047 a ± 101.42 | 1044 |
RNC (mmol kg−1) | 3458 a ± 49.78 | 2357 b ± 87.53 | 3708 b ± 111.68 | 3000 ab ±92.20 | 3254 |
RKC (mmol kg−1) | 1328 a ± 68.20 | 808 c ± 80.81 | 1134 ab ± 22.68 | 970 bc ± 77.48 | 1245 |
SNaK (ratio) | 2.47 a ± 0.38 | 2.59 a ± 0.19 | 2.33 a ± 0.47 | 2.01 a ± 0.41 | 2.4 |
RNaK (ratio) | 2.6 a ± 0.30 | 3.0 a ± 0.43 | 3.3 a ± 0.17 | 3.1 a ± 0.31 | 3 |
Genes | MSU ID | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|---|
OsHKT1;1 | LOC_Os06g48810 | GGCGTTTCTGGCATCAACTGTC | ATTCCAGTCGACAGCACCGAAC |
OsNHX1 | LOC_Os07g47100 | TGACCGTGAGGTTGCCCTTATG | GAGAATGCCGCTCAAATCTAGCAA |
OsSOS1 | LOC_Os12g44360 | AGATCGCGCTTACTCTTGCTGTC | AGACCTCCAGTGCATCTTGTGC |
OsHAK20 | LOC_Os02g31940 | CGAGGGTTGGTGTACCTGAT | GGTTTTTCCTCAAGCGAGTG |
OsMADS25 | LOC_Os04g23910 | CTCTGGAGAAAGCACGTCAA | GACTCAATTCAAGGTCAATACACAC |
STRK1 | LOC_Os04g45730 | CCTCGACGCCAACATGAA | TGAGGTGTGGGTCTACGTATC |
OsA6 | LOC_Os09g32550 | CGAGAAGCTGAACGAGACG | CGAGTTGAAGGCGTAGCTG |
OsFBX335 | LOC_Os09g32860 | CAGTGCCTAGCCTTCCAGAG | TGACGAAAAGCACGAGACAC |
OsLOL5 | LOC_Os01g42710.1 | GCAACCCACAAGAACTAACTCATC | GGCTTGTCCATACCATCTTGAAC |
OsPPa6 | LOC_Os02g52940 | TGAGCTTGACTGGAAAATTGTG | GCTTCTCAACATCATCCACATC |
OsY3IP1 | LOC_Os01g58470.1 | CCAGGTCAAAAGGGTGCTTG | TCTCCTTCGCAAGCAACTGA |
OsIRO3 | LOC_Os03g26210 | TGGTCGATTGGTTTTCAGCAG | AACCTTCCTCGGGACCTTCT |
OsEF1α | LOC_Os03g08010 | TTGATCTGGTCAAGAGCCTCAAGC | TCTCTGGGTTTGAGGGTGACAACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shaban, A.S.; Safhi, F.A.; Fakhr, M.A.; Pruthi, R.; Abozahra, M.S.; El-Tahan, A.M.; Subudhi, P.K. Comparison of the Morpho-Physiological and Molecular Responses to Salinity and Alkalinity Stresses in Rice. Plants 2024, 13, 60. https://doi.org/10.3390/plants13010060
Shaban AS, Safhi FA, Fakhr MA, Pruthi R, Abozahra MS, El-Tahan AM, Subudhi PK. Comparison of the Morpho-Physiological and Molecular Responses to Salinity and Alkalinity Stresses in Rice. Plants. 2024; 13(1):60. https://doi.org/10.3390/plants13010060
Chicago/Turabian StyleShaban, Abdelghany S., Fatmah Ahmed Safhi, Marwa A. Fakhr, Rajat Pruthi, Mahmoud S. Abozahra, Amira M. El-Tahan, and Prasanta K. Subudhi. 2024. "Comparison of the Morpho-Physiological and Molecular Responses to Salinity and Alkalinity Stresses in Rice" Plants 13, no. 1: 60. https://doi.org/10.3390/plants13010060