Next Issue
Volume 9, February
Previous Issue
Volume 8, December
 
 

Processes, Volume 9, Issue 1 (January 2021) – 185 articles

Cover Story (view full-size image): Lactoferrin (Lf) is an iron-binding glycoprotein that is naturally found in milk from many mammals. Lf represents a powerful tool in the host-defense mechanism. However, with low availability during development and aging, Lf is often taken as an oral supplement. As the adult stomach rapidly digests Lf due to enzymatic hydrolysis, an effective encapsulation technique needs to be designed. Here, the particles from gas-saturated solutions (PGSS) were performed to encapsulate Lf with a natural enteric polymer, shellac, using scCO2. Temperatures and pressures were optimized, and the encapsulation efficiency was assessed. Finally, sustained-release profiles of Lf from shellac microcapsules were evaluated. View this paper
  • Issues are regarded as officially published after their release is announced to the table of contents alert mailing list.
  • You may sign up for e-mail alerts to receive table of contents of newly released issues.
  • PDF is the official format for papers published in both, html and pdf forms. To view the papers in pdf format, click on the "PDF Full-text" link, and use the free Adobe Reader to open them.
Order results
Result details
Section
Select all
Export citation of selected articles as:
19 pages, 412 KiB  
Review
Life Cycle Assessment of Renewable Reductants in the Ferromanganese Alloy Production: A Review
by Gerrit Ralf Surup, Anna Trubetskaya and Merete Tangstad
Processes 2021, 9(1), 185; https://doi.org/10.3390/pr9010185 - 19 Jan 2021
Cited by 8 | Viewed by 3711
Abstract
This study examined the literature on life cycle assessment on the ferromanganese alloy production route. The environmental impacts of raw material acquisition through the production of carbon reductants to the production of ferromanganese alloys were examined and compared. The transition from the current [...] Read more.
This study examined the literature on life cycle assessment on the ferromanganese alloy production route. The environmental impacts of raw material acquisition through the production of carbon reductants to the production of ferromanganese alloys were examined and compared. The transition from the current fossil fuel-based production to a more sustainable production route was reviewed. Besides the environmental impact, policy and socioeconomic impacts were considered due to evaluation course of differences in the production routes. Charcoal has the potential to substantially replace fossil fuel reductants in the upcoming decades. The environmental impact from current ferromanganese alloy production can be reduced by ≥20% by the charcoal produced in slow pyrolysis kilns, which can be further reduced by ≥50% for a sustainable production in high-efficient retorts. Certificated biomass can ensure a sustainable growth to avoid deforestation and acidification of the environment. Although greenhouse gas emissions from transport are low for the ferromanganese alloy production, they may increase due to the low bulk density of charcoal and the decentralized production of biomass. However, centralized charcoal retorts can provide additional by-products or biofuel and ensure better product quality for the industrial application. Further upgrading of charcoal can finally result in a CO2 neutral ferromanganese alloy production for the renewable power supply. Full article
Show Figures

Figure 1

48 pages, 11917 KiB  
Article
Evolutionary Algorithm to Support Field Architecture Scenario Screening Automation and Optimization Using Decentralized Subsea Processing Modules
by Mariana J. C. Díaz Arias, Allyne M. dos Santos and Edmary Altamiranda
Processes 2021, 9(1), 184; https://doi.org/10.3390/pr9010184 - 19 Jan 2021
Cited by 3 | Viewed by 3066
Abstract
Manual generation of test cases and scenario screening processes, during field architecture concept development, may produce a limited number of solutions that do not necessarily lead to an optimal concept selection. For more complex subsea field architectures, which might include processing modules for [...] Read more.
Manual generation of test cases and scenario screening processes, during field architecture concept development, may produce a limited number of solutions that do not necessarily lead to an optimal concept selection. For more complex subsea field architectures, which might include processing modules for enhancing pressure and thermal management for the production network, the number of configuration cases and scenarios to evaluate can be extremely large and time and resource-consuming to handle through conventional manual design processes. This paper explores the use of evolutionary algorithms (EA) to automate case generation, scenario screening, and optimization of decentralized subsea processing modules during field development. An evaluation of various genetic operators and evolution strategies was performed to compare their performance and suitability to the application. Based on the evaluation results, an EA using structural uniform crossover and a gradient plus boundary mutation as the main variation operators was developed. The methodology combines EA and an integrated modeling approach to automate and optimize the concept selection and field architecture design when considering decentralized subsea processing modules. Full article
(This article belongs to the Section Advanced Digital and Other Processes)
Show Figures

Figure 1

16 pages, 1481 KiB  
Article
Model Predictive Control for the Process of MEA Absorption of CO2 Based on the Data Identification Model
by Qianrong Li, Wenzhao Zhang, Yuwei Qin and Aimin An
Processes 2021, 9(1), 183; https://doi.org/10.3390/pr9010183 - 19 Jan 2021
Cited by 7 | Viewed by 3827
Abstract
The absorption process of CO2 by ethanolamine solution is essentially a dynamic system, which is greatly affected by the power plant startup and flue gas load changes. Hence, studying the optimal control of the CO2 chemical capture process has always been [...] Read more.
The absorption process of CO2 by ethanolamine solution is essentially a dynamic system, which is greatly affected by the power plant startup and flue gas load changes. Hence, studying the optimal control of the CO2 chemical capture process has always been an important part in academic fields. Model predictive control (MPC) is a very effective control strategy used for such process, but the most intractable problem is the lack of accurate and effective model. In this work, Aspen Plus and Aspen Plus Dynamics are used to establish the process of monoethanolamine (MEA) absorption of CO2 related models based on subspace identification. The nonlinear distribution of the system under steady-state operation is analyzed. Dynamic tests were carried out to understand the dynamic characteristics of the system under variable operating conditions. Systematic subspace identification on open-loop experimental data was performed. We designed a model predictive controller based on the identified model combined with the state-space equation using Matlab/Simulink to analyze the changes of the system under two different disturbances. The simulation results show that the control performance of the MPC algorithm is significantly better than that of the traditional proportion integral differential (PID) system, with excellent setpoint tracking ability and robustness, which improve the stability and flexibility of the system. Full article
(This article belongs to the Special Issue Carbon Capture and Utilisation)
Show Figures

Figure 1

11 pages, 541 KiB  
Article
Preparation of Polymer Bitumen Binder in the Presence of a Stabilizer
by Yerzhan Imanbayev, Anar Akkenzheyeva, Akkenzhe Bussurmanova, Akmaral Serikbayeva and Assiya Boranbayeva
Processes 2021, 9(1), 182; https://doi.org/10.3390/pr9010182 - 19 Jan 2021
Cited by 13 | Viewed by 3207
Abstract
The article presents the results of research on the production of polymer-bitumen binder (PBB) based on mixtures of non-oxidized and oxidized petroleum products, namely high-viscosity tar, darkened vacuum distillate, and oxidized petroleum bitumen 70/100, obtained at technological installations of Limited Liability Partnership (LLP) [...] Read more.
The article presents the results of research on the production of polymer-bitumen binder (PBB) based on mixtures of non-oxidized and oxidized petroleum products, namely high-viscosity tar, darkened vacuum distillate, and oxidized petroleum bitumen 70/100, obtained at technological installations of Limited Liability Partnership (LLP) “JV Caspi Bitum’’ and styrene-butadiene-styrene (SBS) block copolymer brand L 30-01A modifier in the presence of a stabilizer. The results obtained show that the introduction of the SBS modifier in the presence of a sulfur stabilizer improves the performance characteristics of PBB, such as elasticity, ductility, softening temperature, penetration, and brittleness temperature. Full article
(This article belongs to the Special Issue Heavy Oils Conversion Processes)
Show Figures

Figure 1

11 pages, 2900 KiB  
Article
Transesterification Using Ultrasonic Spray of Triolein Containing CaO Particles into Methanol Vapor in a 3-Phase Reactor
by Ravisut Vitidsant, Satoshi Kodama and Hidetoshi Sekiguchi
Processes 2021, 9(1), 181; https://doi.org/10.3390/pr9010181 - 19 Jan 2021
Cited by 2 | Viewed by 2233
Abstract
Ultrasonic spraying was used in a three-phase reactor to produce small droplets of triolein mixed with CaO as a solid catalyst at temperatures above the boiling point of methanol for enhancement of the transesterification of triolein. Droplets fell in the methanol countercurrent flow [...] Read more.
Ultrasonic spraying was used in a three-phase reactor to produce small droplets of triolein mixed with CaO as a solid catalyst at temperatures above the boiling point of methanol for enhancement of the transesterification of triolein. Droplets fell in the methanol countercurrent flow and were collected at the bottom of the reactor, followed by circulation to the ultrasonic spray system. The experimental parameters included triolein flow rates of 2.5–9.0 mL/min, reaction temperatures of 70–100 °C, and catalyst contents of 1.0–7.0 wt%. The methanol feed rate was set to be constant. The results suggested that the enhancement was successful after using the three-phase reactor by generating a high contact surface area for the droplets, which was a key factor for determining the performance. Comparing the results with conventional transesterification in the liquid phase using the same CaO at 60 °C, the three-phase reactor produced a methyl ester yield 2–5% higher during the 60 min trial period. However, the yield became lower after 60 min because the mass transfer of methanol to the droplets was limited. The transesterification kinetics were estimated based on the experimental data—assuming a first-order reaction—and the results indicated a range of the rate constant, an apparent activation energy, and a pre-exponential factor of 1.21–3.70 × 10−2 min−1, 36.1 kJ mol−1, and 64.9 min−1, respectively, suggesting that the three-phase reactor was effective for fast transesterification at the initial stage. Full article
Show Figures

Figure 1

19 pages, 4707 KiB  
Article
Thermal Efficiency, Heat Transfer, and Friction Factor Analyses of MWCNT + Fe3O4/Water Hybrid Nanofluids in a Solar Flat Plate Collector under Thermosyphon Condition
by Bahaa Saleh and Lingala Syam Sundar
Processes 2021, 9(1), 180; https://doi.org/10.3390/pr9010180 - 19 Jan 2021
Cited by 24 | Viewed by 2753
Abstract
The heat transfer, friction factor, and collector efficiency are estimated experimentally for multi-walled carbon nanotubes+Fe3O4 hybrid nanofluid flows in a solar flat plate collector under thermosyphon circulation. The combined technique of in-situ growth and chemical coprecipitation was utilized to synthesize [...] Read more.
The heat transfer, friction factor, and collector efficiency are estimated experimentally for multi-walled carbon nanotubes+Fe3O4 hybrid nanofluid flows in a solar flat plate collector under thermosyphon circulation. The combined technique of in-situ growth and chemical coprecipitation was utilized to synthesize the multi-walled carbon nanotubes+Fe3O4 hybrid nanoparticles. The experiments were carried out at volume flow rates from 0.1 to 0.75 L/min and various concentrations from 0.05% to 0.3%. The viscosity and thermal conductivity of the hybrid nanofluids were experimentally measured at different temperatures and concentrations. Due to the improved thermophysical properties of the hybrid nanofluids, the collector achieved better thermal efficiency. Results show that the maximum thermal conductivity and viscosity enhancements are 28.46% and 50.4% at 0.3% volume concentration and 60 °C compared to water data. The Nusselt number, heat transfer coefficient, and friction factor are augmented by 18.68%, 39.22%, and 18.91% at 0.3% volume concentration and 60 °C over water data at the maximum solar radiation. The collector thermal efficiency improved by 28.09% at 0.3 vol. % at 13:00 h daytime and a Reynolds number of 1413 over water data. Empirical correlations were developed for friction factor and Nusselt number. Full article
(This article belongs to the Section Energy Systems)
Show Figures

Figure 1

16 pages, 5127 KiB  
Article
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite
by Mawethu Pascoe Bilibana, Usisipho Feleni, Avril Rae Williams and Emmanuel Iwuoha
Processes 2021, 9(1), 179; https://doi.org/10.3390/pr9010179 - 19 Jan 2021
Cited by 9 | Viewed by 2485
Abstract
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle [...] Read more.
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR. Full article
(This article belongs to the Special Issue Application of Metal-Based Nanoparticles in Electrochemical Systems)
Show Figures

Figure 1

11 pages, 1226 KiB  
Article
Novel Methods Using an Arthrobacter sp. to Create Anaerobic Conditions for Biobutanol Production from Sweet Sorghum Juice by Clostridium beijerinckii
by Chalida Daengbussadee, Lakkana Laopaiboon, Anuphon Kaewmaneewat, Likit Sirisantimethakom and Pattana Laopaiboon
Processes 2021, 9(1), 178; https://doi.org/10.3390/pr9010178 - 19 Jan 2021
Cited by 12 | Viewed by 2378
Abstract
Biobutanol can be produced by Clostridia via an acetone–butanol–ethanol (ABE) fermentation under strictly anaerobic conditions. Oxygen-free nitrogen (OFN) gas is typically used to create anaerobic conditions for ABE fermentations. However, this method is not appropriate for large-scale fermentations as it is quite costly. [...] Read more.
Biobutanol can be produced by Clostridia via an acetone–butanol–ethanol (ABE) fermentation under strictly anaerobic conditions. Oxygen-free nitrogen (OFN) gas is typically used to create anaerobic conditions for ABE fermentations. However, this method is not appropriate for large-scale fermentations as it is quite costly. The aim of this work was to study the feasibility of butanol production from sweet sorghum juice (SSJ) by Clostridium beijerinckii TISTR 1461 using various methods to create anaerobic conditions, i.e., growth of a strictly aerobic bacterium, an Arthrobacter sp., under different conditions and a chemical method using sodium dithionite (SDTN) to consume residual oxygen. SSJ containing 60 g/L of total sugar supplemented with 1.27 g/L of (NH4)2SO4 was used as a substrate for butanol production. The results showed that 0.25 mM SDTN could create anaerobic conditions, but in this case, C.beijerinckii TISTR 1461 could produce butanol at a concentration (PB) of only 8.51 g/L with a butanol productivity (QB) of 0.10 g/L·h. Arthrobacter sp. BCC 72131 could also be used to create anaerobic conditions. Mixed cultures of C.beijerinckii TISTR 1461 and Arthrobacter sp. BCC 72131 created anaerobic conditions by inoculating the C.beijerinckii 4 h after Arthrobacter. This gave a PB of 10.39 g/L with a QB of 0.20 g/L·h. Comparing butanol production with the control treatment (using OFN gas to create anaerobic conditions, yielding a PB of 9.88 g/L and QB of 0.21 g/L·h) indicated that using Arthrobacter sp. BCC 72131 was an appropriate procedure for creating anaerobic conditions for high levels of butanol production by C. beijerinckii TISTR 1461 from a SSJ medium. Full article
(This article belongs to the Special Issue Bioethanol Production Processes)
Show Figures

Figure 1

13 pages, 2353 KiB  
Article
Culturing of Melanocytes from the Equine Hair Follicle Outer Root Sheath
by Hanluo Li, Jule Kristin Michler, Alexander Bartella, Anna Katharina Sander, Sebastian Gaus, Sebastian Hahnel, Rüdiger Zimmerer, Jan-Christoph Simon, Vuk Savkovic and Bernd Lethaus
Processes 2021, 9(1), 177; https://doi.org/10.3390/pr9010177 - 19 Jan 2021
Cited by 1 | Viewed by 2512
Abstract
Hair follicles harbor a heterogeneous regenerative cell pool and represent a putative low-to-non-invasively available source of stem cells. We previously reported a technology for culturing human melanocytes from the hair follicle outer root sheath (ORS) for autologous pigmentation of tissue engineered skin equivalents. [...] Read more.
Hair follicles harbor a heterogeneous regenerative cell pool and represent a putative low-to-non-invasively available source of stem cells. We previously reported a technology for culturing human melanocytes from the hair follicle outer root sheath (ORS) for autologous pigmentation of tissue engineered skin equivalents. This study translated the ORS technology to horses. We de-veloped a culture of equine melanocytes from the ORS (eMORS) from equine forelock hair follicles cultured by means of an analogue human hair follicle-based in vitro methodology. The procedure was adjusted to equine physiology by addition of equine serum to the culture medium. The hair follicles were isolated by macerating forelock skin rests, enzymatically digested and subjected to air-medium-interface cultivation method. The procedure resulted in differentiated equine melanocytes, which exhibited typical morphology, presence of melanosomes, expression of cytoskeleton proteins vimentin, α-SMA, Sox2, S100ß and tyrosinase as well as tyrosinase activity followed by production of melanin. According to all assessed parameters, eMORS could be ranked as partially melanotic melanocytes. The results of the study offer an experimental base for further insight into hair follicle biology in equine and for comparative studies of hair follicles across different species. Full article
(This article belongs to the Section Biological Processes and Systems)
Show Figures

Figure 1

22 pages, 2945 KiB  
Article
Evaluation of Dissolution Profiles of a Newly Developed Solid Oral Immediate-Release Formula Containing Alpha-Lipoic Acid
by Anca Lucia Pop, Simona Crișan, Maria Bârcă, Anne-Marie Ciobanu, Valentin Nicolae Varlas, Coriolan Pop, Mariana-Ana Pali, Dumitru Cauni, Emma Adriana Ozon, Denisa Udeanu, Simona Trifu and Bogdana Adriana Năsui
Processes 2021, 9(1), 176; https://doi.org/10.3390/pr9010176 - 19 Jan 2021
Cited by 14 | Viewed by 8333
Abstract
Alpha-lipoic acid (ALA, thioctic acid), a naturally-occurring essential dithiol compound, has become a common ingredient in many pharmaceutical and food supplement products (FSP), used in oxidative stress-dependent pathologies; oral bioavailability of ALA is limited by pharmacokinetic particularities that reduce its therapeutic efficacy-reduced solubility, [...] Read more.
Alpha-lipoic acid (ALA, thioctic acid), a naturally-occurring essential dithiol compound, has become a common ingredient in many pharmaceutical and food supplement products (FSP), used in oxidative stress-dependent pathologies; oral bioavailability of ALA is limited by pharmacokinetic particularities that reduce its therapeutic efficacy-reduced solubility, lack of gastric stability and hepatic degradation, doubled by formulation hinders. The objectives were to develop a solid oral 600 mg ALA FSP to obtain an optimal pharmaceutical profile compared to a reference listed drug (RLD) with a similarity factor f2 50. A comparative dissolution study was performed; an HPLC method was used for ALA quantification. After planning combinatory simulations (formulation stage), two prototype formulas (#1 and #2) were manufactured and further optimized by adjusting ALA physical characteristics and the excipients quantities (#3 and #4) in order to achieve the Quality Target Product Profile. A misshapen of ALA’s in vitro release was observed for #3 Formula (f2 = 31.6); the optimal profile was obtained for Formula #4 (f2 = 58.5). A simple quantitative formula is not enough to assure good ALA bioavailability; the formulation needs multiple compounding modulations under physicochemical compatibility algorithms, with multiple dissolution profiles testing back-ups. It is essential to ensure a formulation with an in vitro dissolution comparable with the RLD, allowing the compound to reach its target level to assure the optimum claimed antioxidant activity of ALA at the cellular level, even for food supplement formulations. Full article
(This article belongs to the Special Issue Pharmaceutical Development and Bioavailability Analysis)
Show Figures

Figure 1

16 pages, 4344 KiB  
Article
Extra-Heavy Crude Oil Viscosity Reduction Using and Reusing Magnetic Copper Ferrite Nanospheres
by Lucía Mateus, Esteban A. Taborda, Carlos Moreno-Castilla, María Victoria López-Ramón, Camilo A. Franco and Farid B. Cortés
Processes 2021, 9(1), 175; https://doi.org/10.3390/pr9010175 - 19 Jan 2021
Cited by 11 | Viewed by 3924
Abstract
The main objective of this study is the synthesis, use, and reuse of magnetic copper ferrite nanospheres (CFNS) for extra-heavy oil viscosity reduction. The CFNS were synthesized using a solvothermal method resulting in mean particle size of 150 nm. Interactions of CFNS with [...] Read more.
The main objective of this study is the synthesis, use, and reuse of magnetic copper ferrite nanospheres (CFNS) for extra-heavy oil viscosity reduction. The CFNS were synthesized using a solvothermal method resulting in mean particle size of 150 nm. Interactions of CFNS with the crude oil were evaluated through asphaltene adsorption isotherms, as well as static and dynamic rheology measurements for two cycles at 25 °C. Adsorption and desorption experiments corroborated that most of the asphaltenes adsorbed can be removed for nanoparticle reuse. During the rheology tests, nanoparticles were evaluated in the first cycle at different concentrations from 300 to 1500 mg/L, leading to the highest degree of viscosity reduction of 18% at 500 mg/L. SiO2 nanoparticles were evaluated for comparison issues, obtaining similar results regarding the viscosity reduction. After measurements, the CFNS were removed with a magnet, washed with toluene, and further dried for the second cycle of viscosity reduction. Rheology tests were performed for a second time at a fixed concentration of 500 mg/L, and slight differences were observed regarding the first cycle. Finally, changes in the extra-heavy oil microstructure upon CFNS addition were observed according to the significant decrease in elastic and viscous moduli. Full article
(This article belongs to the Special Issue Redesign Processes in the Age of the Fourth Industrial Revolution)
Show Figures

Figure 1

15 pages, 909 KiB  
Article
Hemicellulosic Bioethanol Production from Fast-Growing Paulownia Biomass
by Elena Domínguez, Pablo G. del Río, Aloia Romaní, Gil Garrote and Lucília Domingues
Processes 2021, 9(1), 173; https://doi.org/10.3390/pr9010173 - 19 Jan 2021
Cited by 15 | Viewed by 3446
Abstract
In order to exploit a fast-growing Paulownia hardwood as an energy crop, a xylose-enriched hydrolysate was obtained in this work to increase the ethanol concentration using the hemicellulosic fraction, besides the already widely studied cellulosic fraction. For that, Paulownia elongata x fortunei was [...] Read more.
In order to exploit a fast-growing Paulownia hardwood as an energy crop, a xylose-enriched hydrolysate was obtained in this work to increase the ethanol concentration using the hemicellulosic fraction, besides the already widely studied cellulosic fraction. For that, Paulownia elongata x fortunei was submitted to autohydrolysis treatment (210 °C or S0 of 4.08) for the xylan solubilization, mainly as xylooligosaccharides. Afterwards, sequential stages of acid hydrolysis, concentration, and detoxification were evaluated to obtain fermentable sugars. Thus, detoxified and non-detoxified hydrolysates (diluted or not) were fermented for ethanol production using a natural xylose-consuming yeast, Scheffersomyces stipitis CECT 1922, and an industrial Saccharomyces cerevisiae MEC1133 strain, metabolic engineered strain with the xylose reductase/xylitol dehydrogenase pathway. Results from fermentation assays showed that the engineered S. cerevisiae strain produced up to 14.2 g/L of ethanol (corresponding to 0.33 g/g of ethanol yield) using the non-detoxified hydrolysate. Nevertheless, the yeast S. stipitis reached similar values of ethanol, but only in the detoxified hydrolysate. Hence, the fermentation data prove the suitability and robustness of the engineered strain to ferment non-detoxified liquor, and the appropriateness of detoxification of liquor for the use of less robust yeast. In addition, the success of hemicellulose-to-ethanol production obtained in this work shows the Paulownia biomass as a suitable renewable source for ethanol production following a suitable fractionation process within a biorefinery approach. Full article
(This article belongs to the Special Issue Bioethanol Production Processes)
Show Figures

Figure 1

11 pages, 1303 KiB  
Article
Thermal Oxidative Stability of Biodiesel/Petrodiesel Blends by Pressurized Differential Scanning Calorimetry and Its Calculated Cetane Index
by Jilliano B. Silva, Josue S. Almeida, Rodrigo V. Barbosa, Glauber J. T. Fernandes, Ana C. F. Coriolano, Valter J. Fernandes, Jr. and Antonio S. Araujo
Processes 2021, 9(1), 174; https://doi.org/10.3390/pr9010174 - 18 Jan 2021
Cited by 6 | Viewed by 3597
Abstract
Diesel fuel mixtures with high concentrations of biodiesel have been investigated to analyze the technical feasibility of their use in diesel cycle engines regarding thermal and oxidative properties. The results of combined techniques of oxidative stability, high Pressurized Differential Scanning Calorimetry (P-DSC), Calculated [...] Read more.
Diesel fuel mixtures with high concentrations of biodiesel have been investigated to analyze the technical feasibility of their use in diesel cycle engines regarding thermal and oxidative properties. The results of combined techniques of oxidative stability, high Pressurized Differential Scanning Calorimetry (P-DSC), Calculated Cetane Index (CCI), and calorific power were used to verify the effect of the thermal-oxidative stability as a function of the percentage of biodiesel in the mixtures. The obtained results evidenced that the thermal and oxidative stability decreased with the addition of biodiesel from 50 to 5% v/v. Low stability fuels require rapid use as the oxidation compounds degrade the product and impair vehicle performance, as well as lead to corrosion and clogging problems in various mechanical systems. Full article
(This article belongs to the Special Issue Biodiesel Production Processes and Technology)
Show Figures

Figure 1

31 pages, 8717 KiB  
Article
Towards Autonomous Operation by Advanced Process Control—Process Analytical Technology for Continuous Biologics Antibody Manufacturing
by Heribert Helgers, Axel Schmidt, Lara Julia Lohmann, Florian Lukas Vetter, Alex Juckers, Christoph Jensch, Mourad Mouellef, Steffen Zobel-Roos and Jochen Strube
Processes 2021, 9(1), 172; https://doi.org/10.3390/pr9010172 - 18 Jan 2021
Cited by 28 | Viewed by 6012
Abstract
Continuous manufacturing opens up new operation windows with improved product quality in contrast to documented lot deviations in batch or fed-batch operations. A more sophisticated process control strategy is needed to adjust operation parameters and keep product quality constant during long-term operations. In [...] Read more.
Continuous manufacturing opens up new operation windows with improved product quality in contrast to documented lot deviations in batch or fed-batch operations. A more sophisticated process control strategy is needed to adjust operation parameters and keep product quality constant during long-term operations. In the present study, the applicability of a combination of spectroscopic methods was evaluated to enable Advanced Process Control (APC) in continuous manufacturing by Process Analytical Technology (PAT). In upstream processing (USP) and aqueous two-phase extraction (ATPE), Raman-, Fourier-transformed infrared (FTIR), fluorescence- and ultraviolet/visible- (UV/Vis) spectroscopy have been successfully applied for titer and purity prediction. Raman spectroscopy was the most versatile and robust method in USP, ATPE, and precipitation and is therefore recommended as primary PAT. In later process stages, the combination of UV/Vis and fluorescence spectroscopy was able to overcome difficulties in titer and purity prediction induced by overlapping side component spectra. Based on the developed spectroscopic predictions, dynamic control of unit operations was demonstrated in sophisticated simulation studies. A PAT development workflow for holistic process development was proposed. Full article
(This article belongs to the Section Biological Processes and Systems)
Show Figures

Figure 1

21 pages, 8028 KiB  
Article
Numerical Study on Unsteady Pressure Distribution on Bulk Carrier in Head Waves with Forward Speed
by Kyung-Kyu Yang, Beom-Soo Kim, Yonghwan Kim, Masashi Kashiwagi and Hidetsugu Iwashita
Processes 2021, 9(1), 171; https://doi.org/10.3390/pr9010171 - 18 Jan 2021
Cited by 3 | Viewed by 1793
Abstract
This study deals with wave-induced unsteady pressure on a ship moving with a constant forward speed in regular head waves. Two different numerical methods are applied to solve wave–ship interaction problems: a Rankine panel method which adopts velocity potential, and a Cartesian-grid method [...] Read more.
This study deals with wave-induced unsteady pressure on a ship moving with a constant forward speed in regular head waves. Two different numerical methods are applied to solve wave–ship interaction problems: a Rankine panel method which adopts velocity potential, and a Cartesian-grid method which solves the momentum and mass conservation equations under the assumption of inviscid and incompressible fluids. Before comparing l1ocal pressure distributions, the computational methods are validated for global quantities, such as ship motion responses and added resistance, by comparison with available experimental data. Then, the computational results and experimental data are compared for hydrodynamic pressure, particularly focusing on the magnitude of the first-harmonic component in different sections and vertical locations. Furthermore, the Cartesian-grid method is used to simulate the various wave-amplitude conditions, and the characteristics of the zeroth-, first-, and second-harmonic components of wave-induced pressure are investigated. The nonlinearity of pressure distribution is observed mostly from the pressure near the still-water-level of the ship bow and the normalized first-harmonic component of wave-induced pressure decreases as the wave steepness increases. Lastly, to understand the local characteristics of wave-induced unsteady pressure, the time-averaged added pressure and added local force are analyzed. It is found that the major contribution of the time-averaged added local force that occurs around the ship stem above the design waterline. Full article
(This article belongs to the Special Issue Theoretical and Numerical Marine Hydrodynamics)
Show Figures

Figure 1

15 pages, 2734 KiB  
Article
Selective Determination of Dopamine in Pharmaceuticals and Human Urine Using Carbon Quantum Dots as a Fluorescent Probe
by Xiupei Yang, Fangming Tian, Shaohua Wen, Hua Xu, Lin Zhang and Jie Zeng
Processes 2021, 9(1), 170; https://doi.org/10.3390/pr9010170 - 18 Jan 2021
Cited by 9 | Viewed by 2739
Abstract
A cost-effective and environmentally friendly method was formulated for rapid dopamine (DA) detection that was based on the fluorescence (FL) quenching of carbon quantum dots (C-dots). Upon adding DA to the C-dots’ solution, we noticed a regular reduction in their fluorescence intensity. The [...] Read more.
A cost-effective and environmentally friendly method was formulated for rapid dopamine (DA) detection that was based on the fluorescence (FL) quenching of carbon quantum dots (C-dots). Upon adding DA to the C-dots’ solution, we noticed a regular reduction in their fluorescence intensity. The effects of pH, amount of C-dots, reaction temperature and time on the determination of DA were investigated. Under the optimized experimental conditions, trace amounts of DA could be analyzed. Furthermore, dopamine hydrochloride injection and human urine samples with and without spiked DA were analyzed using the developed sensing system. The procedure was validated following the guidelines of the European Medicines Agency (EMA) in terms of the following: calibration range (0.3–100 μM), linearity (R2 = 0.9991), limit of detection (LOD) (93 nM). Recoveries of dopamine with spiked samples at three different levels were between 95.0 and 105.9%, and the relative standard deviations (RSDs) were within 2.68% (n = 6). This method is simple and suitable for the determination of dopamine in pharmaceuticals and human urine for clinical application. Compared with previous reports, the proposed method offers great advantages including ease of C-dot sensor preparation (one-pot synthesis), environmentally friendly sample preparation by using either water or phosphate buffer solution only, a short response time and selectivity. Full article
Show Figures

Figure 1

22 pages, 3118 KiB  
Article
Hydrothermally Reduced Graphene Hydrogel Intercalated with Divalent Ions for Dye Adsorption Studies
by Alvin Lim Teik Zheng, Supakorn Boonyuen, Teruhisa Ohno and Yoshito Andou
Processes 2021, 9(1), 169; https://doi.org/10.3390/pr9010169 - 18 Jan 2021
Cited by 17 | Viewed by 2796
Abstract
Fundamental studies involving divalent ion intercalated graphene-based hydrogel are still lacking in terms of their adsorption behavior towards dye pollutants. In this study, we prepared a self-assembled Mg2+ and Ca2+ intercalated reduced graphene hydrogel (rGH) using hydrothermal treatment to evaluate the [...] Read more.
Fundamental studies involving divalent ion intercalated graphene-based hydrogel are still lacking in terms of their adsorption behavior towards dye pollutants. In this study, we prepared a self-assembled Mg2+ and Ca2+ intercalated reduced graphene hydrogel (rGH) using hydrothermal treatment to evaluate the intercalation impact on the adsorption capability towards cationic dyes, methylene blue and rhodamine B. The morphological, structural, thermal, and textural properties of the divalent ion intercalated reduced graphene hydrogels were studied using Fourier transform infrared spectrometer, thermogravimetric analysis, Raman spectroscopy, scanning electron microscope-energy dispersive spectroscopy, X-ray photoelectron spectroscopy, Brunauer–Emmett–Teller surface area analysis, and X-ray diffraction. The increased adsorption capacity of the divalent ion intercalated reduced graphene-based hydrogels towards the dye molecules resulted from the increase in the specific surface area and pore volume due to the Mg2+ and Ca2+ bridging that formed spaces between the graphene sheets framework. Adsorption kinetics and the equilibrium adsorption isotherm were fitted by a pseudo-second-order alongside intraparticle diffusion kinetic models and Langmuir isotherm respectively. In addition, the divalent ion intercalated reduced graphene hydrogel showed good generation after three cycles of simultaneous adsorption. Full article
(This article belongs to the Special Issue Wastewater Treatment Processes)
Show Figures

Figure 1

16 pages, 2748 KiB  
Article
Optimal Design of a Hydrolysis Sugar Membrane Purification System Using a Superstructure-Based Approach
by Chien-Yuan Su, Bo-Yan Ji, Pei-Jung Yu, Ming-Hua Wang, Wei-Chun Hung, Ying-Hsi Chang and Jui-Yuan Lee
Processes 2021, 9(1), 168; https://doi.org/10.3390/pr9010168 - 18 Jan 2021
Cited by 1 | Viewed by 1953
Abstract
As an alternative to gasoline, bioethanol can be produced from lignocellulosic biomass through hydrolysis using an ionic solution containing zinc chloride (ZnCl2). This method allows for a high yield of glucose from lignocellulose, but entails the removal of ZnCl2 from [...] Read more.
As an alternative to gasoline, bioethanol can be produced from lignocellulosic biomass through hydrolysis using an ionic solution containing zinc chloride (ZnCl2). This method allows for a high yield of glucose from lignocellulose, but entails the removal of ZnCl2 from the hydrolysate using multiple nanofiltration membranes before the fermentation of glucose. This paper presents a mathematical technique for designing such a multistage membrane separation system. The optimization model for the synthesis of membrane networks is based on a superstructure with all feasible interconnections between the membrane units, and consists of mass balances, logical constraints and product specifications. A case study of the separation of a bagasse hydrolysis solution is used to demonstrate the application of the proposed model. Results show that using both types of nanofiltration membranes allows higher ZnCl2 removal ratios at each membrane unit, hence a decrease in the number of membrane units required and a reduction of about 35% in capital cost compared to the cases in which only one membrane type is used. Further analysis is performed to examine the effect of membrane performance on the economics of the separation system. Full article
(This article belongs to the Special Issue Multi-Period Optimization of Sustainable Energy Systems)
Show Figures

Figure 1

11 pages, 3405 KiB  
Article
Improvement of Water Solubility of Mercaptoundecahydrododecaborate (BSH)-Peptides by Conjugating with Ethylene Glycol Linker and Interaction with Cyclodextrin
by Mizuki Kitamatsu, Ayaka Nakamura-Tachibana, Yoshimichi Ishikawa and Hiroyuki Michiue
Processes 2021, 9(1), 167; https://doi.org/10.3390/pr9010167 - 18 Jan 2021
Cited by 7 | Viewed by 2611
Abstract
We previously developed a conjugate consisting of 10B cluster BSH and tri-arginine peptide (BSH-3R). This could potentially be used as a boron agent for boron neutron capture therapy; however, it possesses poor water solubility and thus needs to be improved for use [...] Read more.
We previously developed a conjugate consisting of 10B cluster BSH and tri-arginine peptide (BSH-3R). This could potentially be used as a boron agent for boron neutron capture therapy; however, it possesses poor water solubility and thus needs to be improved for use as medicine. In this study, we devised several means of improving the water solubility of BSH-3R. As one of them, we used cyclodextrin (CD), which was expected to improve the water solubility resulting from interaction of the BSH-3R with CD. We evaluated the solubility of BSH-3R in aqueous CD solution by using reverse-phase high-performance liquid chromatography. As we expected, the solubility of BSH-3R was increased in a manner dependent on the addition of β-CD and γ-CD in aqueous solution. Furthermore, we synthesized BSH conjugated to oligoarginine having various chain lengths (BSH-nR) and BSH-3R with ethylene glycol linkers introduced between BSH and 3R (BSH-nEg-3R). The water solubility of these BSH peptides was also evaluated and the results showed that the introduction of nEg to BSH-3R markedly improved the water solubility. Furthermore, we found that the water solubility of these peptides can be further improved by also applying CD. Full article
(This article belongs to the Special Issue Advances of Peptide Engineering)
Show Figures

Figure 1

23 pages, 4132 KiB  
Article
A Novel Mutual Information and Partial Least Squares Approach for Quality-Related and Quality-Unrelated Fault Detection
by Majed Aljunaid, Yang Tao and Hongbo Shi
Processes 2021, 9(1), 166; https://doi.org/10.3390/pr9010166 - 18 Jan 2021
Cited by 9 | Viewed by 2419
Abstract
Partial least squares (PLS) and linear regression methods are widely utilized for quality-related fault detection in industrial processes. Standard PLS decomposes the process variables into principal and residual parts. However, as the principal part still contains many components unrelated to quality, if these [...] Read more.
Partial least squares (PLS) and linear regression methods are widely utilized for quality-related fault detection in industrial processes. Standard PLS decomposes the process variables into principal and residual parts. However, as the principal part still contains many components unrelated to quality, if these components were not removed it could cause many false alarms. Besides, although these components do not affect product quality, they have a great impact on process safety and information about other faults. Removing and discarding these components will lead to a reduction in the detection rate of faults, unrelated to quality. To overcome the drawbacks of Standard PLS, a novel method, MI-PLS (mutual information PLS), is proposed in this paper. The proposed MI-PLS algorithm utilizes mutual information to divide the process variables into selected and residual components, and then uses singular value decomposition (SVD) to further decompose the selected part into quality-related and quality-unrelated components, subsequently constructing quality-related monitoring statistics. To ensure that there is no information loss and that the proposed MI-PLS can be used in quality-related and quality-unrelated fault detection, a principal component analysis (PCA) model is performed on the residual component to obtain its score matrix, which is combined with the quality-unrelated part to obtain the total quality-unrelated monitoring statistics. Finally, the proposed method is applied on a numerical example and Tennessee Eastman process. The proposed MI-PLS has a lower computational load and more robust performance compared with T-PLS and PCR. Full article
Show Figures

Figure 1

12 pages, 1456 KiB  
Communication
Fermentation of Ferulated Arabinoxylan Recovered from the Maize Bioethanol Industry
by Mayra A. Mendez-Encinas, Dora E. Valencia-Rivera, Elizabeth Carvajal-Millan, Humberto Astiazaran-Garcia, Valérie Micard and Agustín Rascón-Chu
Processes 2021, 9(1), 165; https://doi.org/10.3390/pr9010165 - 18 Jan 2021
Cited by 3 | Viewed by 2720
Abstract
Maize by-product from the bioethanol industry (distiller’s dried grains with solubles, DDGS) is a source of ferulated arabinoxylan (AX), which is a health-promoting polysaccharide. In the present study, AX from DDGS was fermented by a representative colonic bacterial mixture (Bifidobacterium longum, [...] Read more.
Maize by-product from the bioethanol industry (distiller’s dried grains with solubles, DDGS) is a source of ferulated arabinoxylan (AX), which is a health-promoting polysaccharide. In the present study, AX from DDGS was fermented by a representative colonic bacterial mixture (Bifidobacterium longum, Bifidobacterium adolescentis, and Bacteroides ovatus), and the effect of the fermented AX (AX-f) on the proliferation of the cell line Caco-2 was investigated. AX was efficiently metabolized by these bacteria, as evidenced by a decrease in the polysaccharide molecular weight from 209 kDa to < 50 kDa in AX-f, the release of ferulic acid (FA) from polysaccharide chains (1.14 µg/mg AX-f), and the short-chain fatty acids (SCFA) production (277 µmol/50 mg AX). AX-f inhibited the proliferation of Caco-2 cells by 80–40% using concentrations from 125–1000 µg/mL. This dose-dependent inverse effect was attributed to the increased viscosity of the media due to the polysaccharide concentration. The results suggest that the AX-f dose range and the SCFA and free FA production are key determinants of antiproliferative activity. Using the same polysaccharide concentrations, non-fermented AX only inhibited the Caco-2 cells proliferation by 8%. These findings highlight the potential of AX recovered from the maize bioethanol industry as an antiproliferative agent once fermented by colonic bacteria. Full article
(This article belongs to the Special Issue Novel Added-Products Manufacturing from Agro-Food Wastes)
Show Figures

Figure 1

25 pages, 3063 KiB  
Review
A Review on Theory and Modelling of Nanomechanical Sensors for Biological Applications
by Jose Jaime Ruz, Oscar Malvar, Eduardo Gil-Santos, Daniel Ramos, Montserrat Calleja and Javier Tamayo
Processes 2021, 9(1), 164; https://doi.org/10.3390/pr9010164 - 16 Jan 2021
Cited by 19 | Viewed by 3375
Abstract
Over the last decades, nanomechanical sensors have received significant attention from the scientific community, as they find plenty of applications in many different research fields, ranging from fundamental physics to clinical diagnosis. Regarding biological applications, nanomechanical sensors have been used for characterizing biological [...] Read more.
Over the last decades, nanomechanical sensors have received significant attention from the scientific community, as they find plenty of applications in many different research fields, ranging from fundamental physics to clinical diagnosis. Regarding biological applications, nanomechanical sensors have been used for characterizing biological entities, for detecting their presence, and for characterizing the forces and motion associated with fundamental biological processes, among many others. Thanks to the continuous advancement of micro- and nano-fabrication techniques, nanomechanical sensors have rapidly evolved towards more sensitive devices. At the same time, researchers have extensively worked on the development of theoretical models that enable one to access more, and more precise, information about the biological entities and/or biological processes of interest. This paper reviews the main theoretical models applied in this field. We first focus on the static mode, and then continue on to the dynamic one. Then, we center the attention on the theoretical models used when nanomechanical sensors are applied in liquids, the natural environment of biology. Theory is essential to properly unravel the nanomechanical sensors signals, as well as to optimize their designs. It provides access to the basic principles that govern nanomechanical sensors applications, along with their intrinsic capabilities, sensitivities, and fundamental limits of detection. Full article
(This article belongs to the Section Biological Processes and Systems)
Show Figures

Figure 1

19 pages, 4060 KiB  
Article
Oxygen-Blown Gasification of Pulp Mill Bark Residues for Synthetic Fuel Production
by Fredrik Weiland, Sandra Lundström and Yngve Ögren
Processes 2021, 9(1), 163; https://doi.org/10.3390/pr9010163 - 15 Jan 2021
Cited by 6 | Viewed by 2870
Abstract
Synthetic fuel production via gasification of residual biomass streams from the pulp and paper industry can be an opportunity for the mills to enable improved resource utilization and at the same time reduce the production of excess heat. This paper summarizes initial oxygen-blown [...] Read more.
Synthetic fuel production via gasification of residual biomass streams from the pulp and paper industry can be an opportunity for the mills to enable improved resource utilization and at the same time reduce the production of excess heat. This paper summarizes initial oxygen-blown gasification experiments with two bark residues from a European pulp and paper mill, i.e., a softwood bark and a hardwood bark. The gasification process was characterized by measuring syngas yields and process efficiency to find optimum operating conditions. In addition, impurities in the syngas and ash behavior were characterized. Maximum yields of CO and H2 were obtained from softwood bark and amounted to approximately 29 and 15 mol/kg fuel, respectively. Optimum cold gas efficiency was achieved at an oxygen stoichiometric ratio of λ = 0.40 and was approximately 76% and 70% for softwood bark and hardwood bark, respectively. Increased λ had a reducing effect on pollutants in the syngas, e.g., higher hydrocarbons, NH3, HCl, and soot. The situation for sulfur species was more complex. Evaluation of the bark ashes indicated that slag formation could start already from 800 °C. Furthermore, a non-intrusive laser diagnostics technique gave rapid feedback on the millisecond scale. Measured syngas temperature and water content were in good agreement with the applied reference methods. Full article
(This article belongs to the Special Issue Process Design of Biomass Thermochemical Conversion)
Show Figures

Figure 1

22 pages, 3159 KiB  
Article
Ethylene Polymerization via Zirconocene Catalysts and Organoboron Activators: An Experimental and Kinetic Modeling Study
by Luis Valencia, Francisco Enríquez-Medrano, Ricardo López-González, Priscila Quiñonez-Ángulo, Enrique Saldívar-Guerra, José Díaz-Elizondo, Iván Zapata-González and Ramón Díaz de León
Processes 2021, 9(1), 162; https://doi.org/10.3390/pr9010162 - 15 Jan 2021
Cited by 3 | Viewed by 3881
Abstract
Forty years after the discovery of metallocene catalysts, there are still several aspects that remain unresolved, especially when the “conventional” alkylaluminum activators are not used. Herein, we systematically investigated the synthesis of polyethylene (PE) via three different zirconocene catalysts, with different alkyl substituents, [...] Read more.
Forty years after the discovery of metallocene catalysts, there are still several aspects that remain unresolved, especially when the “conventional” alkylaluminum activators are not used. Herein, we systematically investigated the synthesis of polyethylene (PE) via three different zirconocene catalysts, with different alkyl substituents, activated via different organoboron compounds. The polymerization behavior, as well as the properties of the materials, were evaluated. The results demonstrate that the highest catalytic activity is shown by bis(cyclopentadienyl)dimethylzirconium activated by trityl tetra(pentafluorophenyl)borate. Additionally, it was found that toluene is the optimum solvent for these systems and at these reaction conditions. Moreover, to validate our experimental results, a comprehensive mathematical model was developed on the basis of thermodynamic and kinetic principles. The concentration of ethylene transferred to the solvent phase (toluene) in a liquid–vapor equilibrium (LVE) system was estimated based on Duhem’s theorem. Arrhenius expressions for the kinetic rate constants of a proposed kinetic mechanism were estimated by a kinetic model, in which the rate of polymerization was fitted by a least-square optimization procedure and the molecular weight averages by the method of moments. The simulations of the coordination polymerization suggest the presence of two types of active sites, principally at low temperatures, and the reactivation of the deactivated sites via a boron-based activator. However, the effect of the temperature on the reactivation step was not clear; a deeper understanding via designed experiments is required. Full article
(This article belongs to the Special Issue Modeling and Simulation of Polymerization Processes)
Show Figures

Graphical abstract

17 pages, 1730 KiB  
Review
Use of Black Soldier Fly Larvae for Food Waste Treatment and Energy Production in Asian Countries: A Review
by Chul-Hwan Kim, JunHee Ryu, Jongkeun Lee, Kwanyoung Ko, Ji-yeon Lee, Ki Young Park and Haegeun Chung
Processes 2021, 9(1), 161; https://doi.org/10.3390/pr9010161 - 15 Jan 2021
Cited by 68 | Viewed by 27515
Abstract
Food waste accounts for a substantial portion of the organic waste generated at an increasing rate worldwide. Organic waste, including food waste, is largely subjected to landfill disposal, incineration, and anaerobic digestion; however, more sustainable methods are needed for treating it. Treatment of [...] Read more.
Food waste accounts for a substantial portion of the organic waste generated at an increasing rate worldwide. Organic waste, including food waste, is largely subjected to landfill disposal, incineration, and anaerobic digestion; however, more sustainable methods are needed for treating it. Treatment of organic waste using black soldier fly (Hermetia illucens) larvae is an environmentally safe and cost-efficient method that has been attracting increasing attention worldwide. Black soldier fly decomposes various types of organic waste and converts them into high-value biomasses such as oils and proteins. This review introduces the trends in research related to the treatment of organic waste by black soldier fly (Hermetia illucens) larvae (BSFL) and their bioconversion efficiencies in Asian countries. Perspectives on the growth of BSFL during waste treatment operation and optimal rearing conditions are provided. The trends in studies related to the application of BSFL as biofuel and animal feed are also discussed. Such use of BSFL would be beneficial in Asia, especially in countries where the technology for processing organic waste is not readily available. This review may provide further directions of investigations including culture techniques for industrial scale applications of BSFL in food waste treatment and resource production in Asian countries. Full article
Show Figures

Figure 1

18 pages, 3549 KiB  
Article
Impacts of Low-Carbon Targets and Hydrogen Production Alternatives on Energy Supply System Transition: An Infrastructure-Based Optimization Approach and a Case Study of China
by Tianxiao Li, Pei Liu and Zheng Li
Processes 2021, 9(1), 160; https://doi.org/10.3390/pr9010160 - 15 Jan 2021
Cited by 12 | Viewed by 2665
Abstract
Low-carbon transition pathways oriented from different transition targets would result in a huge variation of energy system deployment and transition costs. Hydrogen is widely considered as an imperative energy carrier to reach carbon neutral targets. However, hydrogen production, either from non-fossil power or [...] Read more.
Low-carbon transition pathways oriented from different transition targets would result in a huge variation of energy system deployment and transition costs. Hydrogen is widely considered as an imperative energy carrier to reach carbon neutral targets. However, hydrogen production, either from non-fossil power or fossil fuels with carbon capture, is closely linked with an energy supply system and has great impacts on its structure. Identifying an economically affordable transition pathway is attractive, and energy infrastructure is critical due to massive investment and long life-span. In this paper, a multi-regional, multi-period, and infrastructure-based model is proposed to quantify energy supply system transition costs with different low-carbon targets and hydrogen production alternatives, and China is taken as a case study. Results show that, fulfilling 2-degree and 1.5-degree temperature increase targets would result in 84% and 151% increases in system transition costs, 114% and 246% increases in infrastructure investment, and 211% and 339% increases in stranded investment, compared to fulfilling stated policy targets. Producing hydrogen from coal would be economical when carbon capture and sequestration cost is lower than 437 yuan per tonne, and reduce infrastructure investment and stranded coal investment by 16% and 35% respectively, than producing hydrogen from renewable power. Full article
(This article belongs to the Special Issue Redesign Processes in the Age of the Fourth Industrial Revolution)
Show Figures

Figure 1

13 pages, 2390 KiB  
Article
Effects of Temperature and Extraction Time on Avocado Flesh (Persea americana) Total Phenolic Yields Using Subcritical Water Extraction
by Walid I. Mazyan, Ellen O’Connor, Elia Martin, Anja Vogt, Edward Charter and Ali Ahmadi
Processes 2021, 9(1), 159; https://doi.org/10.3390/pr9010159 - 15 Jan 2021
Cited by 4 | Viewed by 2269
Abstract
This paper investigates the optimum extraction temperature for enhanced total phenolic yields extracted from avocado fruit flesh (Persea americana) using subcritical water extraction, as well as the impact of fruit ripeness on phenol extraction efficiency. Additionally, extraction yield against extraction time [...] Read more.
This paper investigates the optimum extraction temperature for enhanced total phenolic yields extracted from avocado fruit flesh (Persea americana) using subcritical water extraction, as well as the impact of fruit ripeness on phenol extraction efficiency. Additionally, extraction yield against extraction time was investigated for time intervals of 10 min over an overall extraction time of 30 min. The subcritical water conditions studied were 18 bar, 87 mL/min, and temperatures of 105 °C, 120 °C, and 140 °C. The total phenolic compounds content was compared for week one avocado flesh and ripe (week four) avocado flesh, with a four-week ripening period between the two samples. The results show that extracting with subcritical water at 105 °C provides the highest phenolic compounds yields of 0.11% and 0.26% by dried mass for week one and ripe fruit (week four), respectively. The experimental results also indicate that the implementation of lower extraction temperatures on week four avocado (i.e., following the selection of week one avocados and allowing them to ripen over a period of one month) enhances the phenolic compounds extraction yields by more than four times relative to the first week’s sample extract, specifically during the first 20 min of extraction. Full article
(This article belongs to the Special Issue Advances in Supercritical Fluid Extraction)
Show Figures

Figure 1

10 pages, 1389 KiB  
Article
Catalytic Oxidation of Heavy Residual Oil by Pulsed Nuclear Magnetic Resonance
by Alexey V. Vakhin, Elena I. Cherkasova, Aliya G. Safiulina, Galiya G. Islamova, Sergey M. Petrov and Natalya Yu. Bashkirtseva
Processes 2021, 9(1), 158; https://doi.org/10.3390/pr9010158 - 15 Jan 2021
Cited by 7 | Viewed by 1983
Abstract
A study on the catalytic oxidation of heavy residual oil (HRO) was carried out. The thermodynamic parameters of components of HRO oxidation products were studied by pulsed nuclear magnetic resonance (NMR). A method for the quantitative assessment of thermodynamic parameters of HRO components [...] Read more.
A study on the catalytic oxidation of heavy residual oil (HRO) was carried out. The thermodynamic parameters of components of HRO oxidation products were studied by pulsed nuclear magnetic resonance (NMR). A method for the quantitative assessment of thermodynamic parameters of HRO components and oxidized bitumen using pulsed NMR is presented. The relationship between NMR parameters and the viscosity of HRO and its oxidation products is established. The obtained results prove the possibility of using pulsed NMR as a flow-line method for rapid analysis of intermediates and products of the heavy residual oil oxidation. Full article
(This article belongs to the Special Issue Dynamic Modeling and Control in Chemical and Energy Processes)
Show Figures

Figure 1

15 pages, 4187 KiB  
Article
Role of Mixed Oxides in Hydrogen Production through the Dry Reforming of Methane over Nickel Catalysts Supported on Modified γ-Al2O3
by Ahmed Sadeq Al-Fatesh, Mayankkumar Lakshmanbhai Chaudhary, Anis Hamza Fakeeha, Ahmed Aidid Ibrahim, Fahad Al-Mubaddel, Samsudeen Olajide Kasim, Yousef Abdulrahman Albaqmaa, Abdulaziz A. Bagabas, Rutu Patel and Rawesh Kumar
Processes 2021, 9(1), 157; https://doi.org/10.3390/pr9010157 - 15 Jan 2021
Cited by 24 | Viewed by 2565
Abstract
H2 production through dry reforming of methane (DRM) is a hot topic amidst growing environmental and atom-economy concerns. Loading Ni-based reducible mixed oxide systems onto a thermally stable support is a reliable approach for obtaining catalysts of good dispersion and high stability. [...] Read more.
H2 production through dry reforming of methane (DRM) is a hot topic amidst growing environmental and atom-economy concerns. Loading Ni-based reducible mixed oxide systems onto a thermally stable support is a reliable approach for obtaining catalysts of good dispersion and high stability. Herein, NiO was dispersed over MOx-modified-γ-Al2O3 (M = Ti, Mo, Si, or W; x = 2 or 3) through incipient wetness impregnation followed by calcination. The obtained catalyst systems were characterized by infrared, ultraviolet–visible, and X-ray photoelectron spectroscopies, and H2 temperature-programmed reduction. The mentioned synthetic procedure afforded the proper nucleation of different NiO-containing mixed oxides and/or interacting-NiO species. With different modifiers, the interaction of NiO with the γ-Al2O3 support was found to change, the Ni2+ environment was reformed exclusively, and the tendency of NiO species to undergo reduction was modified greatly. Catalyst systems 5Ni3MAl (M = Si, W) comprised a variety of species, whereby NiO interacted with the modifier and the support (e.g., NiSiO3, NiAl2O4, and NiWO3). These two catalyst systems displayed equal efficiency, >70% H2 yield at 800 °C, and were thermally stable for up to 420 min on stream. 5Ni3SiAl catalyst regained nearly all its activity during regeneration for up to two cycles. Full article
Show Figures

Figure 1

35 pages, 2750 KiB  
Review
Nitrogen Removal from Agricultural Subsurface Drainage by Surface-Flow Wetlands: Variability
by Lipe Renato Dantas Mendes
Processes 2021, 9(1), 156; https://doi.org/10.3390/pr9010156 - 15 Jan 2021
Cited by 7 | Viewed by 2361
Abstract
Agriculture has long been considered a great source of nitrogen (N) to surface waters and a major cause of eutrophication. Thus, management practices at the farm-scale have since attempted to mitigate the N losses, although often limited in tile-drained agricultural catchments, which speed [...] Read more.
Agriculture has long been considered a great source of nitrogen (N) to surface waters and a major cause of eutrophication. Thus, management practices at the farm-scale have since attempted to mitigate the N losses, although often limited in tile-drained agricultural catchments, which speed up the N transport, while minimizing natural removal in the landscape. In this context, surface-flow constructed wetlands (SFWs) have been particularly implemented as an edge-of-field strategy to intercept tile drains and reduce the N loads by re-establishing ecosystems services of previously drained water ponded areas. These systems collect the incoming water volumes in basins sufficiently large to prolong the hydraulic residence time to a degree where biogeochemical processes between the water, soil, sediments, plants, macro and microorganisms can mediate the removal of N. Despite their documented suitability, great intra and inter-variability in N treatment is still observed to date. Therefore, it is essential to thoroughly investigate the driving factors behind performance of SFWs, in order to support their successful implementation according to local catchment characteristics, and ensure compliance with N removal goals. This review contextualizes the aforementioned issue, and critically evaluates the influence of hydrochemistry, hydrology and biogeochemistry in the treatment of N by SFWs. Full article
(This article belongs to the Special Issue Gas, Water and Solid Waste Treatment Technology)
Show Figures

Figure 1

Previous Issue
Next Issue
Back to TopTop